Single nucleotide polymorphisms at heat shock protein 90 gene and their association with thermo-tolerance potential in selected indigenous Nigerian cattle

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

Download Full-text

The effect of single-nucleotide polymorphisms within heat shock protein beta 1 on beef quantity in Korean native steers

Archives Animal Breeding ◽

10.5194/aab-63-417-2020 ◽

2020 ◽

Vol 63 (2) ◽

pp. 417-422

Author(s):

Jung-Keun Suh ◽

Jae-Sung Lee ◽

Hongsik Kong ◽

Yoonseok Lee ◽

Hong-Gu Lee

Keyword(s):

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Heat Shock Protein ◽

Direct Sequencing ◽

Muscle Growth ◽

Least Square ◽

Nucleotide Polymorphisms ◽

Single Nucleotide ◽

Fat Thickness ◽

The Relationship

Abstract. Heat shock protein beta 1 (HSPB1), a member of the heat-shock family of protein, is a relatively small (27 kDa) molecular chaperone protein associated with cellular development. The relationship between HSPB1 expression and muscle growth in beef cattle has previously been reported, but there have been no reports of DNA markers related to meat quantity in Korean native steers. Therefore, the aim of this study was to evaluate the relationship of single-nucleotide polymorphisms (SNPs) within HSPB1 in terms of the carcass traits related to muscle growth in Korean native steers. Through direct sequencing, we discovered three SNPs: g.111 T > C SNP (rs208395876) and g.2548 C > G SNP (rs483014585) were respectively located in 5′ UTR (untranslated region) and 3′ UTR. Further, g.2352 T > C SNP (rs110832311) was located in the adjacent region of the RNA splicing site. The least square means of steers with a CC genotype of g.111 T > C SNP had a significantly higher meat ratio (P = 0.04), while the least square means of steers with a CC genotype of g.2352 T > C SNP had a significantly higher meat ratio (P = 0.002) and lower back-fat thickness (P = 0.004) than those of the other genotype. Moreover, although the least square means of steers with CC-CC, CT-CC, and TT-CC genotypes were significantly decreased for back-fat thickness, they were significantly increased for the meat ratio. Therefore, our results suggested that g.111 T > C SNP and g.2352 T > C SNP could be a causal mutation related to an adipose metabolism in Korean cattle steer.

Download Full-text

Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus

Journal of Human Genetics ◽

10.1038/jhg.2013.89 ◽

2013 ◽

Vol 58 (11) ◽

pp. 707-710 ◽

Cited By ~ 7

Author(s):

Jeshina Janardhanan ◽

Sherry Joseph Martin ◽

Elisabeth Astrup ◽

R Veeramanikandan ◽

Pål Aukrust ◽

...

Keyword(s):

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Heat Shock Protein ◽

Heat Shock Protein 70 ◽

Scrub Typhus ◽

Nucleotide Polymorphisms ◽

Toll Like Receptor ◽

Single Nucleotide

Download Full-text

Novel single nucleotide polymorphisms in the heat shock protein 70.1 gene in South African Nguni crossbred cattle

Tropical Animal Health and Production ◽

10.1007/s11250-019-02088-6 ◽

2019 ◽

Vol 52 (2) ◽

pp. 893-901 ◽

Cited By ~ 1

Author(s):

Lwamkelekile Sitshilelo Mkize ◽

Oliver Tendayi Zishiri

Keyword(s):

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Heat Shock Protein ◽

South African ◽

Nucleotide Polymorphisms ◽

Crossbred Cattle ◽

Single Nucleotide

Download Full-text

Effects of single nucleotide polymorphisms in the 5′-flanking region of heat shock protein 70.2 gene on semen quality in boars

Animal Reproduction Science ◽

10.1016/s0378-4320(01)00202-0 ◽

2002 ◽

Vol 70 (1-2) ◽

pp. 99-109 ◽

Cited By ~ 34

Author(s):

S.Y. Huang ◽

M.Y. Chen ◽

E.C. Lin ◽

H.L. Tsou ◽

Y.H. Kuo ◽

...

Keyword(s):

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Heat Shock Protein ◽

Semen Quality ◽

Nucleotide Polymorphisms ◽

Single Nucleotide ◽

Flanking Region

Download Full-text

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

Reproduction Fertility and Development ◽

10.1071/rdv22n1ab246 ◽

2010 ◽

Vol 22 (1) ◽

pp. 280

Author(s):

C. Rosenkrans Jr ◽

M. Roe ◽

M. Brown ◽

Z. Johnson ◽

H. Brown ◽

...

Keyword(s):

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Plasma Concentrations ◽

Pcr Amplification ◽

Hsp70 Gene ◽

Nucleotide Polymorphisms ◽

Single Nucleotide ◽

Julian Date ◽

Forage System ◽

Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

Download Full-text

Discovery of Coding Genetic Variants Influencing Diabetes-Related Serum Biomarkers and Their Impact on Risk of Type 2 Diabetes

The Journal of Clinical Endocrinology & Metabolism ◽

10.1210/jc.2014-3677 ◽

2015 ◽

Vol 100 (4) ◽

pp. E664-E671 ◽

Cited By ~ 13

Author(s):

Tarunveer Singh Ahluwalia ◽

Kristine Højgaard Allin ◽

Camilla Helene Sandholt ◽

Thomas Hempel Sparsø ◽

Marit Eika Jørgensen ◽

...

Keyword(s):

Type 2 Diabetes ◽

Heat Shock ◽

Single Nucleotide Polymorphisms ◽

Genetic Variants ◽

Binding Protein ◽

Nucleotide Polymorphisms ◽

Single Nucleotide ◽

Igf Binding ◽

Igf Binding Protein

Context: Type 2 diabetes (T2D) prevalence is spiraling globally, and knowledge of its pathophysiological signatures is crucial for a better understanding and treatment of the disease. Objective: We aimed to discover underlying coding genetic variants influencing fasting serum levels of nine biomarkers associated with T2D: adiponectin, C-reactive protein, ferritin, heat shock 70-kDa protein 1B, IGF binding protein 1 and IGF binding protein 2, IL-18, IL-2 receptor-α, and leptin. Design and Participants: A population-based sample of 6215 adult Danes was genotyped for 16 340 coding single-nucleotide polymorphisms and were tested for association with each biomarker. Identified loci were tested for association with T2D through a large-scale meta-analysis involving up to 17 024 T2D cases and up to 64 186 controls. Results: We discovered 11 associations between single-nucleotide polymorphisms and five distinct biomarkers at a study-wide P < 3.4 × 10−7. Nine associations were novel: IL18: BIRC6, RAD17, MARVELD2; ferritin: F5; IGF binding protein 1: SERPING1, KLKB, GCKR, CELSR2, and heat shock 70-kDa protein 1B: CFH. Three of the identified loci (CELSR2, HNF1A, and GCKR) were significantly associated with T2D, of which the association with the CELSR2 locus has not been shown previously. Conclusion: The identified loci influence processes related to insulin signaling, cell communication, immune function, apoptosis, DNA repair, and oxidative stress, all of which could provide a rationale for novel diabetes therapeutic strategies.

Download Full-text