Phylogenetic analysis of the genus Pseudoroegneria and the Triticeae tribe using the rbcL gene

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Download Full-text

PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

Indonesian Journal of Agricultural Science ◽

10.21082/ijas.v6n1.2005.20-27 ◽

2013 ◽

Vol 6 (1) ◽

pp. 20 ◽

Cited By ~ 2

Author(s):

Panca J. Santoso ◽

Ghizan B. Saleh ◽

Norihan M. Saleh ◽

Suhaimi Napis

Keyword(s):

Phylogenetic Analysis ◽

Phylogenetic Relationships ◽

Rflp Analysis ◽

Restriction Enzymes ◽

Rbcl Gene ◽

Research Station ◽

Taxonomic Level ◽

Pcr Rflp ◽

Young Leaves ◽

Reliable Marker

Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

Download Full-text

Phylogenetic Analysis of Eight Malaysian Pineapple Cultivars using a Chloroplastic Marker (rbcL gene)

Jurnal Teknologi ◽

10.11113/jt.v64.2041 ◽

2013 ◽

Vol 64 (2) ◽

Author(s):

Norfadilah Hamdan ◽

Azman Abd Samad ◽

Topik Hidayat ◽

Faezah Mohd Salleh

Keyword(s):

Phylogenetic Analysis ◽

Sequence Similarity ◽

Accurate Method ◽

Ananas Comosus ◽

Rbcl Gene ◽

Ribulose Bisphosphate Carboxylase ◽

Ribulose Bisphosphate ◽

Parsimony Method ◽

Bisphosphate Carboxylase ◽

Maximum Parsimony Method

To date, Malaysian pineapple cultivars has only been characterized morphologically. A more consistent and accurate method such as biomarker is highly crucial to distinguish and establish the genetic relationship between different cultivars. In this work, we conducted a phylogenetic analysis of eight Malaysian pineapple cultivars using a chloroplastic DNA biomarker, ribulose-bisphosphate carboxylase (rbcL) gene. The rbcL gene was isolated from genomic DNA, amplified and sequenced. The rbcL gene of Ananas comosus is approximately 1100 bp. From the multialignment of eight cultivars, the percentage of sequence similarity ranged from 71.1% to 94.98% and is highly conserved throughout the sequences. Phylogenetic analysis which is carried out using maximum parsimony method revealed that the eight Malaysian pineapple cultivars can be classified into two groups. The first group consist of Yankee and Gandul cultivars while Moris, Moris Bentanggur, Moris Gajah, N36, Josaphine and Sarawak falls under the second group. Bootstrap values in some branches are low which reflect the small number of informative characters (981 are conserved, 12 are potentially informative). Formation of several group or subclades is due to its similar genetic pattern, thus supporting this classification. This study confirmed that rbcL gene is a good indicator to determine the phylogenetic relationship distinguishing the Malaysian pineapple cultivars.

Download Full-text

Species diversity and phylogenetic analysis of Heliconia spp. collections of Purwodadi Botanic Garden (East Java, Indonesia) inferred by rbcL gene sequences

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d200505 ◽

2019 ◽

Vol 20 (5) ◽

Cited By ~ 1

Author(s):

LIA HAPSARI ◽

TRIMANTO TRIMANTO ◽

DIDIK WAHYUDI

Keyword(s):

Phylogenetic Analysis ◽

Species Diversity ◽

Genetic Variability ◽

Morphological Characteristics ◽

Pairwise Distance ◽

Rbcl Gene ◽

Gene Sequences ◽

Botanic Garden ◽

Rbcl Gene Sequences ◽

Rbcl Sequences

Abstract. Hapsari L, Trimanto, Wahyudi D. 2019. Species diversity and phylogenetic analysis of Heliconia spp. collections of Purwodadi Botanic Garden (East Java, Indonesia) inferred by rbcL gene sequences. Biodiversitas 20: 1266-1283. Heliconia L. is a single genus in the family Heliconiaceae, with approximate consists of 200 species. It has wide morphological variations among and within species which led to problems in species identification. Species diversity and phylogenetic analysis using morphology and rbcL marker subjected to 17 Heliconia spp. living collections of Purwodadi Botanic Garden (PBG) have been conducted. The rbcL gene located in chloroplast genome is one of appropriate proposed marker for plant barcoding assessment. This study aimed to study morphology and genetic variability of the PBG Heliconiaceae collections, to confirms the species name for a more accurate identity record and to reveal the diversity and phylogenetics of the species. Morphological characterization showed high variability among Heliconia species, which included 3 subgenera (Heliconia, Stenochlamys, and Griggsia) and 1 hybrid. Each species possessed unique morphological characteristics. The common morphological characters which distinguished among and within Heliconia species includes leaf form, inflorescence type, and bract characteristics. Key to the Heliconia species examined is presented in this paper. However, molecular confirmation using rbcL sequences showed high conservation level (0.932) and low genetic variability. About 656 nucleotides were monomorphic and 33 positions were polymorphic which comprised 18 singleton variable sites and 15 parsimony informative sites. Twelve haplotypes were produced with haplotype diversity value 0.8952. Pairwise distance analysis shows that they were shared high similarity of rbcL sequences with very low genetic distance (0.022 to 0.000). The topology of phylogenetic tree resulted by Neighbour-Joining algorithm has the best grouping and be able to explain the relationship among species of Heliconia, although supported by low bootstrap (65). It was separated into two clades following its subgen. classification. Clade 1 consists of subgen. Heliconia and Griggsia; while clade 2 consists of subgen. Heliconia and Stenochlamys; also hybrid species. Further, separation of deeper branchings (section) was inconsistent and unclear. Upon this study, rbcL marker was considered too conserved thus less valuable for phylogenetic analysis at lower taxa among and within Heliconia spp. However, rbcL was suggested to distinguish at higher level taxa between closely related genus and above.

Download Full-text

Preliminary placement and new records of an overlooked Amazonian tree, Christiana mennegae (Malvaceae)

PeerJ ◽

10.7717/peerj.12244 ◽

2021 ◽

Vol 9 ◽

pp. e12244

Author(s):

Rafael G. Barbosa-Silva ◽

Thales Silva Coutinho ◽

Santelmo Vasconcelos ◽

Delmo Fonseca da Silva ◽

Guilherme Oliveira ◽

...

Keyword(s):

Phylogenetic Analysis ◽

New Records ◽

Local Level ◽

Conservation Status ◽

Its2 Region ◽

Rbcl Gene ◽

Morphological Investigation ◽

Phylogenetic Placement ◽

Brazilian Flora ◽

First Time

Christiana mennegae is a phylogenetically enigmatic taxon and represents a case in point of a species whose presence escaped the radar of the Amazon lists and the Brazilian Flora project. Here we expand its distribution by adding new records from Peru and overlooked ones from Brazil. To investigate its phylogenetic placement in the Brownlowioideae, part of the rbcL gene of the plastid and the intergenic ITS2 region were sequenced. Macro- and micro-morphological investigation of features of C. mennegae using SEM of foliar, flower, fruit and seed structures are presented. A lectotype for the name is designated here. The morphology of trichomes revealed five types of trichomes ranging from glandular to branched and unbranched and we also report stomata on the seed surface for the first time in Brownlowioideae. Christiana mennegae and C. africana were recovered as sister species in the phylogenetic analysis, albeit with low to moderate support, and more species of this and closely related genera must be sampled and analyzed in order to obtain a clearer picture of the group’s affinities and relationships. We provide an update of its conservation status from Vulnerable to Least Concern. We also highlight the need for investment in the digitization of biological collections, botanical capacity building at the local level and the importance of the availability of online literature to speed the study of Amazonian plant diversity.

Download Full-text

Phylogenetic analysis of Dipterocarpaceae in Ketambe Research Station, Gunung Leuser National Park (Sumatra, Indonesia) based on rbcL and matK genes

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d190340 ◽

2018 ◽

Vol 19 (3) ◽

pp. 1074-1080 ◽

Cited By ~ 4

Author(s):

ESSY HARNELLY ◽

ZAIRIN THOMY ◽

NIR FATHIYA

Keyword(s):

Phylogenetic Analysis ◽

Phylogenetic Tree ◽

National Park ◽

Sampling Technique ◽

Rbcl Gene ◽

Research Station ◽

Tree Reconstruction ◽

Matk Gene ◽

Aceh Province ◽

Experimental Laboratory

Harnelly E, Thomy Z, Fathiya N. 2018. Phylogenetic analysis of Dipterocarpaceae in Ketambe Research Station, GunungLeuser National Park (Sumatra, Indonesia) based on rbcL and matK genes. Biodiversitas 19: 1074-1080. Gunung Leuser National Parkhas several Research Stations. Ketambe is one of the Research Stations which is located in Aceh Tenggara district, Aceh province. Oneof the timber plants family which is abundant in Leuser Mountain is Dipterocarpaceae. However, the data of species and relationship ofDipterocarpaceae in Ketambe Research Station is lack and not available. The aim of the study is to analyze the phylogenetic ofDipterocarpaceae based on rbcL and matK gene in Ketambe Research Station. This research was carried out from July 2015 to August2016 in Ketambe Research Station and Forestry and Forest Genetics Laboratory of Molecular, Bogor Agricultural University. Themethod used quadrat sampling technique with purposive sampling and experimental laboratory consisting of DNA extraction, PCR,electrophoresis, and sequencing. The data analysis was done using BioEdit and MEGA6. The results showed that based onmorphological identification, there were five Dipterocarpaceae species found namely; Parashorea lucida, Shorea parvifolia, Shorealepidota, Shorea johorensis, and Hopea dryobalanoides. The phylogenetic tree based on rbcL gene showed that there were twomonophyletic groups, the first group was S. johorensis, S. lepidota, and H. dryobalanoides; and the second group consisted of S.parvifolia and P. lucida. The phylogenetic tree reconstruction based on matK gene showed that Shorea parvifolia and S. johorensis wereseparated in two different monophyletic groups.

Download Full-text

PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

Indonesian Journal of Agricultural Science ◽

10.21082/ijas.v6n1.2005.p20-27 ◽

2013 ◽

Vol 6 (1) ◽

pp. 20 ◽

Cited By ~ 4

Author(s):

Panca J. Santoso ◽

Ghizan B. Saleh ◽

Norihan M. Saleh ◽

Suhaimi Napis

Keyword(s):

Phylogenetic Analysis ◽

Phylogenetic Relationships ◽

Rflp Analysis ◽

Restriction Enzymes ◽

Rbcl Gene ◽

Research Station ◽

Taxonomic Level ◽

Pcr Rflp ◽

Young Leaves ◽

Reliable Marker

Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

Download Full-text