Establishing community-wide DNA barcode references for conserving mangrove forests in China

Background Mangrove ecosystems have been the focus of global attention for their crucial role in sheltering coastal communities and retarding global climate change by sequestering ‘blue carbon’. China is relatively rich in mangrove diversity, with one-third of the ca. 70 true mangrove species and a number of mangrove associate species occurring naturally along the country’s coasts. Mangrove ecosystems, however, are widely threatened by intensifying human disturbances and rising sea levels. DNA barcoding technology may help protect mangrove ecosystems by providing rapid species identification. Results To investigate this potential, 898 plant specimens were collected from 33 major mangrove sites in China. Based on the morphologic diagnosis, the specimens were assigned to 72 species, including all 28 true mangrove species and all 12 mangrove associate species recorded in China. Three chloroplast DNA markers rbcL, trnH-psbA, matK, and one nuclear marker ITS2 were chosen to investigate the utility of using barcoding to identify these species. According to the criteria of barcoding gaps in genetic distance, sequence similarity, and phylogenetic monophyly, we propose that a single marker, ITS2, is sufficient to barcode the species of mangroves and their associates in China. Furthermore, rbcL or trnH-psbA can also be used to gather supplement confirming data. In using these barcodes, we revealed a very low level of genetic variation among geographic locations in the mangrove species, which is an alert to their vulnerability to climate and anthropogenic disturbances. Conclusion We suggest using ITS2 to barcode mangrove species and terrestrial coastal plants in South China. The DNA barcode sequences we obtained would be valuable in monitoring biodiversity and the restoration of ecosystems, which are essential for mangrove conservation.

PHYTOREMEDIATION OF HEAVY METALS BY THE DOMINANT MANGROVE ASSOCIATE SPECIES OF INDIAN SUNDARBANS

The present study aims to investigate the phytoremediation potential of zinc (Zn), copper (Cu), and lead (Pb) by two dominant mangrove associate species, Suaeda maritima, and Salicornia brachiata, found in the high saline supralittoral zone of Indian Sundarbans in four stations of the Hooghly-Matla estuarine complex during the premonsoon season (May 2019). We found that concentrations of biologically available heavy metals (HMs) in the ambient soil and bioaccumulated HMs within the vegetative plant parts occurred as per the order: Sagar South > Bakkhali > Jharkhali > Bali Island. The order of biologically available and bioaccumulated HMs was Zn > Cu > Pb. Interestingly, the selected HMs display high organ-specificity for both species with the highest enrichment in roots, followed by stems and leaves. We propose that these halophytes could be used as agents of phytoremediation and their farming would be effective in the ecorestoration of this deltaic complex in context to conservative pollutants.

A C2H2-Type Zinc-Finger Protein from Millettia pinnata, MpZFP1, Enhances Salt Tolerance in Transgenic Arabidopsis

C2H2 zinc finger proteins (ZFPs) play important roles in plant development and response to abiotic stresses, and have been studied extensively. However, there are few studies on ZFPs in mangroves and mangrove associates, which represent a unique plant community with robust stress tolerance. MpZFP1, which is highly induced by salt stress in the mangrove associate Millettia pinnata, was cloned and functionally characterized in this study. MpZFP1 protein contains two zinc finger domains with conserved QALGGH motifs and targets to the nucleus. The heterologous expression of MpZFP1 in Arabidopsis increased the seeds’ germination rate, seedling survival rate, and biomass accumulation under salt stress. The transgenic plants also increased the expression of stress-responsive genes, including RD22 and RD29A, and reduced the accumulation of reactive oxygen species (ROS). These results indicate that MpZFP1 is a positive regulator of plant responses to salt stress due to its activation of gene expression and efficient scavenging of ROS.

Grass phytoliths in surface sediments of the Sunderbans, India and their implications in reconstructing past deltaic environmental changes

Reliability of grass phytoliths for discriminating different deltaic sub-environments has been assessed on the modern surface sediments collected along the salinity gradient of the Sunderbans delta, India. It has been observed that grass phytolith assemblages can successfully distinguish different deltaic sub-environments especially the true mangrove zones from the mangrove associate and non-mangrove zones with minor overlaps, which further corroborated with the results of discriminant analysis (DA). Detrended correspondence analysis (DCA) and redundancy analysis (RDA) performed on the surface grass phytolith data show that salinity is the most crucial environmental parameter influencing grass phytolith distribution in the deltaic sub-environments. The potential of modern grass phytolith data in reconstructing past deltaic environmental changes has been further assessed on a late Quaternary fossil phytolith spectra from the Sunderbans spanning a sedimentary record for the last ~13.6 ka. A true mangrove environment with discernible tidal influence has been revealed between 13.6 and 3.9 ka. Absence of true mangrove–indicator grass phytoliths between ~3.9 and 2.2 ka further suggests disappearance of mangrove vegetation from this part of the Sunderbans which might have recolonized during ~2.2–0.8 ka. A mangrove associated or non-mangrove environment with little or no tidal influence came into existence in the study area since 0.8 ka onwards. A comparison with some earlier records suggests that the present grass phytolith-based palaeoenvironmental data shows conformity with the past dynamics in mangrove ecosystem in the east coast of India in respect to relative sea level changes.

Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Evaluation of Phytochemicals and Bioactive Properties in Mangrove Associate Suaeda monoica Forssk. ex J.F.Gmel. of Indian Sundarbans

Suaeda monoica Forssk. ex J.F.Gmel. (Amaranthaceae), a mangrove associate and ethno-medicinal herb of Indian Sundarbans, was investigated as a promising source of bioactive compounds. Various polar and nonpolar solvent extracts of the leaf and root-shoot parts of the plant exhibited antioxidant, antibacterial, antifungal, allelopathic, mosquitocidal, antihaemolytic and antidiuretic potential. Moreover, to meet pharmacological requirements, the antioxidant ability of the plant was validated by both chemical and biological analyses. Extraction yield and presence of different phytochemicals like phenolics, flavonoids, tannins and saponins were compared in various solvent-extracted fractions. Principle component analysis revealed that the antioxidant property present in different extracts maintained a positive correlation with the occurrence of polyphenols (phenolics, tannins and flavonoids). Biochemical evaluation, HPLC examination and GC–MS analysis showed a differential level of the presence of various phytochemicals in different solvent extracts. In contrast to mosquitocidal, antioxidant, antihaemolytic and phytotoxic properties which were observed to be dominant in polar solvent extracts, maximum antibacterial potency was detected in nonpolar n-hexane fractions. Overall, the plant extract is nontoxic in nature and a dose amounting to 3,000 mg/kg was well tolerated by Swiss albino mice. A combination of HPLC and GC–MS analyses showed the presence of a large number of structurally diverse phytochemicals, many of which had already been reported as insecticidal, mosquitocidal, antibacterial, herbicidal, antidiuretic, antioxidant and anti-haemolytic compounds. All these findings support that the least explored traditional edible medicinal mangrove associate S.monoica is enriched with multiple bioactive molecules and may be considered as one of the richest sources of various lead molecules of pharmaceutical importance.

Rediscovery of Flagellaria indica from Sundarban Biosphere Reserve, West Bengal, India

Flagellaria indica, a mangrove associate is rediscovered from the mangrove forests of Sundarban Biosphere Reserve of West Bengal, India after a lapse of 117 years. Detailed description, photo plate and notes on its distribution, habitat and uses are provided.

Prominent genetic structure across native and introduced ranges of Pluchea indica, a mangrove associate, as revealed by microsatellite markers

Aims Pluchea indica is a mangrove-associate species, known for its medicinal properties in its native range and being invasive in part of its introduced range. This study aimed to assess geographic distribution of genetic variation of this species across its distribution range, identify the factors influencing its genetic structure and use this information to suggest conservation and management strategies in its native and introduced ranges, respectively. Methods We assessed the genetic diversity and population structure of 348 individuals from 31 populations across its native (Asia) and introduced (USA) ranges for 15 nuclear microsatellite loci. The spatial pattern of genetic variation was investigated at both large and regional spatial scales with the hypothesis that geographic distance and natural geographic barriers would influence the population structure with varying levels of differentiation across spatial scales. Important Findings We found relatively high genetic diversity at the population level and pronounced genetic differentiation in P. indica, as compared with the genetic diversity parameters of mangroves and mangrove associates in this region. Most of the populations showed heterozygote deficiency, primarily due to inbreeding and impediment of gene flow. Analysis of population structures at large spatial scale revealed the presence of two major clusters across the species’ natural range separating populations in China from those in Indonesia, Malaysia, Singapore, Thailand, Cambodia and Philippines, and that the USA population might have been introduced from the population cluster in China. Genetic differentiation between populations was also observed at the regional scale. A large number of populations showed evidence of genetic bottleneck, thereby emphasizing the risk of local extinction. Based on these findings, our study recommends in situ conservation strategies, such as to prioritize populations for conservation actions and to maintain genetic diversity.