Full-length Transcriptome Reconstruction Reveals Genetic Differences in Hybrids of Oryza Sativa and Oryza Punctata With Different Ploidy and Genome Compositions

Background: Allopolyploid breeding is an efficient technique for improving the low seeding rate of autotetraploids in plant breeding and one of the most promising breeding methods. However, there have been few comprehensive studies of the posttranscriptional mechanism in allopolyploids.Results: By crossing cultivated rice (Oryza sativa, genome AA) with wild rice (Oryza punctata, genome BB), we created hybrid rice lines with different ploidy and genome compositions [diploid F01 (AB), allotetraploid F02 (AABB) and F03 (AAAB)]. The genetic differences of the hybrids and the mechanism of allopolyploid breeding dominance were revealed through morphological and cytological observations and single molecule real-time sequencing techniques. The tissues and organs of allotetraploid rice F02 exhibited "gigantism" and the highest levels of fertility. The numbers of non-redundant transcripts, gene loci and new isoforms in the polyploid rice lines were higher and the isoform lengths greater than those of the diploid line. Moreover, alternative splicing (AS) events occurred twice as often in the polyploid rice lines than the diploid line. During these events, intron retention dominated. Furthermore, a large number of new genes and isoforms specific to the lines of different ploidy were discovered. Conclusions: The results indicated that alternative polyadenylation (APA) and AS events contributed to the complexity and superiority of polyploids in the activity of translation regulators, nucleic acid binding transcription factor activities and the regulation of molecular function. Therefore, these APA and AS events in allopolyploid rice were found to play a role in regulation. Our study provides new germplasm for polyploid rice breeding and reveals complex regulatory mechanisms that may be related to heterosis and fertility.

Green and Sustainable Preparation of Flower Like ZnO Nanostructures via Soft Bio-template Approach for the Enhancement of Biomedical Applications

Investigation onthe biomedical applications of flower like Zinc Oxide (ZnO) nanostructures (NSs)synthesized by using aqueous extract of Oryza punctata (red rice) is reported for the first time. For the sustainable preparation of ZnO NSs, the precursors zinc nitrate and the rice extract act as the bio-template material. The powder X-ray diffraction analysis demonstrates the crystallographic structure and purity of the bio-prepared ZnO NSs. Fourier transform infrared spectral studies exhibits the existence of several functional groups in the rice extract and synthesized ZnO NSs. The FT-Raman spectroscopy analysis used to detect the presence of the defects in the synthesized material. The UV absorption onset shows the peaks at 270 nm & 370 nm for rice extract and ZnO NSs, respectively. The optimal energy bandgap value for the ZnO NSs was found to be 3.29 eV. The zinc oxygen vacancies, zinc interstitial and surface defects were determined by photoluminescence spectroscopy. The dynamic light scattering analysis reveals the material stability and average particle size distribution of the prepared ZnO NSs. The flower like morphology of the ZnO NSs was confirmed by field emission scanning electron microscopy analysis. ZnO NSs were tested for cytotoxicity activity against MCF–7 cell line and antibacterial properties using two gram positive (Staphylococcus Aureus, Bacillus Subtilis) and two gram negative bacteria (Salmonella Paratyphi, Escherichia Coli). Significant antioxidant activity was studied by the bio-prepared ZnO NSs against scavenging of DPPH (di(phenyl)-(2,4,6-trinitrophenyl)iminoazanium) free radicals. The flower like ZnO NSs showed a significant anti-arthritic activity which exhibited a maximum inhibition of protein denaturation (78.94±1.62 %) and membrane protective activity (81.12±1.25 %) at a dose of 0.5mg/mL concentration.

Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

A, The Evaluating Allelopathic potential of aqueous extracts of Sow thistle (Sonchus oleraceus L.) on emergence and seedling growth of Red rice (Oryza punctata)

ABSTRACT Chemical weed control method caused environmental hazards and residual effects in crops and soil. Alternate approach to control weeds is getting attentions in sustainable production system. Use of aqueous extracts of weed is getting scientific attention as eco-friendly alternative to chemical herbicides especially under scenario of fast increasing herbicide resistance in weeds. To investigate the herbicidal potential of aqueous extract of winter weed of Sonchus oleraceus L. (Sow thistle) on summer weed Oryza punctate L. (red rice) seed emergence and initial seedling growth, a study was planned. In this study, seeds of O. punctate were incubated in seven concentrations (0, 0.25, 0.50, 1, 2, 4, and 8%) of different parts i.e. leaves, stem, flower of S. oleraceus. All the tested concentrations of various plant parts of S. oleraceus significantly inhibited the mean emergence time, emergence index, emergence percentage (%), time taken to 50% emergence as well as growth of O. punctata weed. However, maximum mean emergence time (5.26 days), minimum germination index (1.69), germination percentage (40%), root length (2.04 cm), shoot length (5.71 cm), fresh weight (59 g), dry weight (4.06 g) was noted at 8% concentration with fruit aqueous extract of S. oleraceus. Seed of O. punctata take maximum time to complete 50% emergence (3.33 days) under control where we applied distilled water. Results suggested fruit extract of S. oleraceus at 8% concentration can be used potential bio-herbicide for the control of O. punctate. Key words: Chemical, eco-friendly, herbicidal potential, fruit extract

Assessing allelopathic potential of Sonchus oleraceus L. (milk thistle) on germination and seedling growth of Oryza puncta

ABSTRACT Aqueous extracts of plants are used to control weeds and having no hazards to environment and are inexpensive. Present study was undertaken to investigate the effect of aqueous extracts of Sonchus oleraceus L. on the Oryza punctata L. emergence and initial seedling growth. It consists of aqueous extract of leaves, stem and fruit of S. oleraceus at varying concentrations 0.25, 0.50, 1, 2, 4 and 8 % (w/v) along with a distilled water control. The allelochemicals present in the aqueous extracts showed stimulatory, inhibitory and hormetic responses depending upon the concentration and the plant part. Results directed that maximum mean emergence time (5.26 days) and minimum germination index (1.67), germination percentage (40%), seedling fresh weight (59 g) and dry weight (8 g) of O. punctata were examined with 8% aqueous extract of S. oleraceus fruit. However, 4% aqueous extract of S. oleraceus fruit produced minimum root length (5.71). On the basis this experiment it was concluded that 8% aqueous extract of S. oleraceus fruit can be used for controlling O. punctata weed. Keywords: Aqueous extract, environment, allelochamicals, hermetic response, stimulatory ABSTRACT Aqueous extracts of plants are used to control weeds and having no hazards to environment and are inexpensive. Present study was undertaken to investigate the effect of aqueous extracts of Sonchus oleraceus L. on the Oryza punctata L. emergence and initial seedling growth. It consists of aqueous extract of leaves, stem and fruit of S. oleraceus at varying concentrations 0.25, 0.50, 1, 2, 4 and 8 % (w/v) along with a distilled water control. The allelochemicals present in the aqueous extracts showed stimulatory, inhibitory and hormetic responses depending upon the concentration and the plant part. Results directed that maximum mean emergence time (5.26 days) and minimum germination index (1.67), germination percentage (40%), seedling fresh weight (59 g) and dry weight (8 g) of O. punctata were examined with 8% aqueous extract of S. oleraceus fruit. However, 4% aqueous extract of S. oleraceus fruit produced minimum root length (5.71). On the basis this experiment it was concluded that 8% aqueous extract of S. oleraceus fruit can be used for controlling O. punctata weed. Keywords: Aqueous extract, environment, allelochamicals, hermetic response, stimulatory ABSTRACT Aqueous extracts of plants are used to control weeds and having no hazards to environment and are inexpensive. Present study was undertaken to investigate the effect of aqueous extracts of Sonchus oleraceus L. on the Oryza punctata L. emergence and initial seedling growth. It consists of aqueous extract of leaves, stem and fruit of S. oleraceus at varying concentrations 0.25, 0.50, 1, 2, 4 and 8 % (w/v) along with a distilled water control. The allelochemicals present in the aqueous extracts showed stimulatory, inhibitory and hormetic responses depending upon the concentration and the plant part. Results directed that maximum mean emergence time (5.26 days) and minimum germination index (1.67), germination percentage (40%), seedling fresh weight (59 g) and dry weight (8 g) of O. punctata were examined with 8% aqueous extract of S. oleraceus fruit. However, 4% aqueous extract of S. oleraceus fruit produced minimum root length (5.71). On the basis this experiment it was concluded that 8% aqueous extract of S. oleraceus fruit can be used for controlling O. punctata weed. Keywords: Aqueous extract, environment, allelochamicals, hermetic response, stimulatory

ALLELOPATHIC INFLUENCE OF POPPY (Papaver somniferum L.) ON EMERGENCE AND INITIAL SEEDLING GROWTH OF RED RICE (Oryza punctata L.)

Allelopathy plays crucial role in effective weed control. Opium (Papaver somniferum L.) crop release different allelochemicals at maturity which have potential to act as natural weeds control in different crops. Phytotoxic effect of Papaver somniferum was examined on germination and initial seedling growth of red rice (Oryza punctata L.). Aqueous extract of different plant parts (leaves, stem and flower) were used at various concentrations (0.25%, 0.5%, 1%, 2%, 4% and 8%) along with distilled water as control. The aqueous extracts of leaves, stem and flower of P. somniferum were significantly inhibited the emergence, seedling growth as well as root length (cm), shoot length (cm), fresh weight (g) and dry weight (g) of O. punctata. Maximum mean emergence time (9.18 days) and minimum shoot length (1.13 cm) whereas minimum emergence index (0.89) and emergence percentage (6.67%) was observed under fruit extract at 8% concentration. P. somniferum aqueous extract of stem at 8% concentration take maximum time to complete 50% emergence minimum root length, fresh weight, dry weight of O. punctata. Based on this finding it can be concluded that the phyto-chemicals present in P. somniferum at 8% concentration may cause losses to the related as well as succeeding weeds through allelopathy and must be removed from the field to avoid destructive effects of these weeds.

A, The ALLELOPATHIC EFFECT OF AQUEOUS EXTRACT OF CARTHAMUS TINCTORIUS ON GERMINATION AND INITIAL SEEDLING GROWTH OF ORYZA PUNCTATA

ABSTRACT Chemical weed control method creates environmental hazards and residual effects in crops and soil. Alternate approach to control weeds is getting attentions in sustainable production system. Aqueous extract of crop is an important technique to control weed and also environment friendly and cheap. To investigate the herbicidal potential of aqueous extract of winter crop Carthamus tinctorius (safflower) on summer weed Oryza punctata (red rice) seed germination and initial seedling growth, a study was planned in Weed Science Laboratory. In this study, seeds of C. tinctorius were incubated in seven concentrations (0, 0.25, 0.50, 1, 2, 4, and 8%) of different parts i.e. leaves, stem, flower of C. tinctorius. All the tested concentrations of various plant parts of C. tinctorius significantly inhibited the mean emergence time, germination index, germination percentage (%), time taken to 50% germination as well as growth of O. punctata weed. However, maximum mean emergence time (4.73 days), time taken to 50% germination (4.19 days) was noted at 8% concentration and germination index of O. punctata was noted at 0.25% concentration when flower extract was applied. Leaf aqueous extract at the concentration 8% caused the lowest root length (1.53 cm), shoot length (4.51 cm) and fresh weight (54.72 g) of O. punctata. Results suggested leaf and flower extract of C. tinctorius at concentration (8%) can be used potential bio-herbicide for the control of red rice. Key words: Allelopathy, seedling growth, inhibitory, weed growth, plant parts, promotor

Production and cytological characterization of a synthetic amphiploid derived from a cross between Oryza sativa and Oryza punctata

Oryza punctata Kotschy ex Steud. (BB, 2n = 24) is a wild species of rice that has many useful agronomic traits. An interspecific hybrid (AB, 2n = 24) was produced by crossing O. punctata and Oryza sativa variety Punjab Rice 122 (PR122, AA, 2n = 24) to broaden the narrow genetic base of cultivated rice. Cytological analysis of the pollen mother cells (PMCs) of the interspecific hybrids confirmed that they have 24 chromosomes. The F1 hybrids showed the presence of 19–20 univalents and 1–3 bivalents. The interspecific hybrid was treated with colchicine to produce a synthetic amphiploid (AABB, 2n = 48). Pollen fertility of the synthetic amphiploid was found to be greater than 50% and partial seed set was observed. Chromosome numbers in the PMCs of the synthetic amphiploid were 24II, showing normal pairing. Flow cytometric analysis also confirmed doubled genomic content in the synthetic amphiploid. Leaf morphological and anatomical studies of the synthetic amphiploid showed higher chlorophyll content and enlarged bundle sheath cells as compared with both of its parents. The synthetic amphiploid was backcrossed with PR122 to develop a series of addition and substitution lines for the transfer of useful genes from O. punctata with least linkage drag.

Evolutionary Analysis of GH3 Genes in Six Oryza Species/Subspecies and Their Expression under Salinity Stress in Oryza sativa ssp. japonica

Glycoside Hydrolase 3 (GH3), a member of the Auxin-responsive gene family, is involved in plant growth, the plant developmental process, and various stress responses. The GH3 gene family has been well-studied in Arabidopsis thaliana and Zea mays. However, the evolution of the GH3 gene family in Oryza species remains unknown and the function of the GH3 gene family in Oryza sativa is not well-documented. Here, a systematic analysis was performed in six Oryza species/subspecies, including four wild rice species and two cultivated rice subspecies. A total of 13, 13, 13, 13, 12, and 12 members were identified in O. sativa ssp. japonica, O. sativa ssp. indica, Oryza rufipogon, Oryza nivara, Oryza punctata, and Oryza glumaepatula, respectively. Gene duplication events, structural features, conserved motifs, a phylogenetic analysis, chromosome locations, and Ka/Ks ratios of this important family were found to be strictly conservative across these six Oryza species/subspecies, suggesting that the expansion of the GH3 gene family in Oryza species might be attributed to duplication events, and this expansion could occur in the common ancestor of Oryza species, even in common ancestor of rice tribe (Oryzeae) (23.07~31.01 Mya). The RNA-seq results of different tissues displayed that OsGH3 genes had significantly different expression profiles. Remarkably, the qRT-PCR result after NaCl treatment indicated that the majority of OsGH3 genes play important roles in salinity stress, especially OsGH3-2 and OsGH3-8. This study provides important insights into the evolution of the GH3 gene family in Oryza species and will assist with further investigation of OsGH3 genes’ functions under salinity stress.