Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Integration of high-density genetic mapping with transcriptome analysis uncovers numerous agronomic QTL and reveals candidate genes for the control of tillering in sorghum

Phenotypes such as branching, photoperiod sensitivity, and height were modified during plant domestication and crop improvement. Here, we perform quantitative trait locus (QTL) mapping of these and other agronomic traits in a recombinant inbred line (RIL) population derived from an interspecific cross between Sorghum propinquum and Sorghum bicolor inbred Tx7000. Using low-coverage Illumina sequencing and a bin-mapping approach, we generated ∼1920 bin markers spanning ∼875 cM. Phenotyping data were collected and analyzed from two field locations and one greenhouse experiment for six agronomic traits, thereby identifying a total of 30 QTL. Many of these QTL were penetrant across environments and co-mapped with major QTL identified in other studies. Other QTL uncovered new genomic regions associated with these traits, and some of these were environment-specific in their action. To further dissect the genetic underpinnings of tillering, we complemented QTL analysis with transcriptomics, identifying 6189 genes that were differentially expressed during tiller bud elongation. We identified genes such as Dormancy Associated Protein 1 (DRM1) in addition to various transcription factors that are differentially expressed in comparisons of dormant to elongating tiller buds and lie within tillering QTL, suggesting that these genes are key regulators of tiller elongation in sorghum. Our study demonstrates the usefulness of this RIL population in detecting domestication and improvement-associated genes in sorghum, thus providing a valuable resource for genetic investigation and improvement to the sorghum community.

QTL mapping in an interspecific sorghum population uncovers candidate regulators of salinity tolerance

Salt stress impedes plant growth and disrupts normal metabolic processes, resulting in decreased biomass and increased leaf senescence. Therefore, the ability of a plant to maintain biomass when exposed to salinity stress is critical for the production of salt tolerant crops. To identify the genetic basis of salt tolerance in an agronomically important grain crop, we used a recombinant inbred line (RIL) population derived from an interspecific cross between domesticated Sorghum bicolor (inbred Tx7000) and a wild relative, Sorghum propinquum, which have been shown to differ in response to salt exposure. One-hundred seventy-seven F3:5 RILs were exposed to either a control or salt treatment and seven traits related to plant growth and overall health were assessed. A high-density genetic map that covers the 10 Sorghum chromosomes with 1991 markers was used to identify nineteen total QTL related to these traits, ten of which were specific to the salt stress response. Salt-responsive QTL contain numerous genes that have been previously shown to play a role in ionic tolerance, tissue tolerance, and osmotic tolerance, including a large number of aquaporins.

Integration of high-density genetic mapping with transcriptome analysis uncovers numerous agronomic QTL and reveals candidate genes for the control of tillering in sorghum

Phenotypes such as branching, photoperiod sensitivity, and height were modified during plant domestication and crop improvement. Here, we perform quantitative trait locus (QTL) mapping of these and other agronomic traits in a recombinant inbred line (RIL) population derived from an interspecific cross between Sorghum propinquum and Sorghum bicolor inbred Tx7000. Using low-coverage Illumina sequencing and a bin-mapping approach, we generated ~1920 bin markers spanning ~875 cM. Phenotyping data were collected and analyzed from two field locations and one greenhouse experiment for six agronomic traits, thereby identifying a total of 30 QTL. Many of these QTL were penetrant across environments and co-mapped with major QTL identified in other studies. Other QTL uncovered new genomic regions associated with these traits, and some of these were environment-specific in their action. To further dissect the genetic underpinnings of tillering, we complemented QTL analysis with transcriptomics, identifying 6189 genes that were differentially expressed during tiller bud elongation. We identified genes such as Dormancy Associated Protein 1 (DRM1) in addition to various transcription factors that are differentially expressed in comparisons of dormant to elongating tiller buds and lie within tillering QTL, suggesting that these genes are key regulators of tiller elongation in sorghum. Our study demonstrates the usefulness of this RIL population in detecting domestication and improvement-associated genes in sorghum, thus providing a valuable resource for genetic investigation and improvement to the sorghum community.

Genetic Analysis of Recombinant Inbred Lines for Sorghum bicolor × Sorghum propinquum

We describe a recombinant inbred line (RIL) population of 161 F5 genotypes for the widest euploid cross that can be made to cultivated sorghum (Sorghum bicolor) using conventional techniques, S. bicolor × Sorghum propinquum, that segregates for many traits related to plant architecture, growth and development, reproduction, and life history. The genetic map of the S. bicolor × S. propinquum RILs contains 141 loci on 10 linkage groups collectively spanning 773.1 cM. Although the genetic map has DNA marker density well-suited to quantitative trait loci mapping and samples most of the genome, our previous observations that sorghum pericentromeric heterochromatin is recalcitrant to recombination is highlighted by the finding that the vast majority of recombination in sorghum is concentrated in small regions of euchromatin that are distal to most chromosomes. The advancement of the RIL population in an environment to which the S. bicolor parent was well adapted (indeed bred for) but the S. propinquum parent was not largely eliminated an allele for short-day flowering that confounded many other traits, for example, permitting us to map new quantitative trait loci for flowering that previously eluded detection. Additional recombination that has accrued in the development of this RIL population also may have improved resolution of apices of heterozygote excess, accounting for their greater abundance in the F5 than the F2 generation. The S. bicolor × S. propinquum RIL population offers advantages over early-generation populations that will shed new light on genetic, environmental, and physiological/biochemical factors that regulate plant growth and development.

The Selection and Use of Sorghum (Sorghum propinquum) Bacterial Artificial Chromosomes as Cytogenetic FISH Probes for Maize (Zea maysL.)

The integration of genetic and physical maps of maize is progressing rapidly, but the cytogenetic maps lag behind, with the exception of the pachytene fluorescencein situhybridization (FISH) maps of maize chromosome 9. We sought to produce integrated FISH maps of other maize chromosomes using Core Bin Marker loci. Because these 1 Kb restriction fragment length polymorphism (RFLP) probes are below the FISH detection limit, we used BACs from sorghum, a small-genome relative of maize, as surrogate clones for FISH mapping. We sequenced 151 maize RFLP probes and comparedin silicoBAC selection methods to that of library filter hybridization and found the latter to be the best. BAC library screening, clone verification, and single-clone selection criteria are presented along with an example of transgenomic BAC FISH mapping. This strategy has been used to facilitate the integration of RFLP and FISH maps in other large-genome species.