First report ofNeofusicoccum australe[Botryosphaeria australis], a cause of grapevine dieback in New Zealand

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Spiranthes mosaic virus 3 in Phlox spp. in New Zealand

Plant Disease ◽

10.1094/pdis-11-16-1681-pdn ◽

2017 ◽

Vol 101 (5) ◽

pp. 849-849 ◽

Cited By ~ 1

Author(s):

J. Tang ◽

S. Khan ◽

B. Quinn ◽

S. Veerakone ◽

E. Milleza ◽

...

Keyword(s):

New Zealand ◽

Mosaic Virus ◽

First Report

Download Full-text

First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

Plant Disease ◽

10.1094/pdis-05-13-0530-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 420-420 ◽

Cited By ~ 6

Author(s):

S. Chebil ◽

R. Fersi ◽

A. Yakoub ◽

S. Chenenaoui ◽

M. Chattaoui ◽

...

Keyword(s):

Morphological Characteristics ◽

Aerial Mycelium ◽

Its2 Region ◽

Pathogenicity Test ◽

Botryosphaeria Dothidea ◽

Diplodia Seriata ◽

First Report ◽

Grapevine Dieback ◽

Pinus Spp ◽

Neofusicoccum Luteum

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

Download Full-text