First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

Download Full-text

First Report of Wood Canker Caused by Botryosphaeria dothidea, Diplodia seriata, Neofusicoccum parvum, and Lasiodiplodia theobromae on Grapevine in Turkey

Plant Disease ◽

10.1094/pdis-07-13-0726-pdn ◽

2014 ◽

Vol 98 (4) ◽

pp. 568-568 ◽

Cited By ~ 8

Author(s):

D. S. Akgul ◽

N. G. Savas ◽

A. Eskalen

Keyword(s):

Morphological Characteristics ◽

Botryosphaeria Dothidea ◽

Outer Bark ◽

Western Turkey ◽

Diplodia Seriata ◽

Neofusicoccum Parvum ◽

Lasiodiplodia Theobromae ◽

First Report ◽

Multiple Species ◽

Botryosphaeriaceae Species

The Aegean region (western Turkey) is the center of table, raisin, and wine grape cultivation. During the 2012 growing season, wood canker symptoms were observed in vineyards in Manisa city. Symptoms adjacent to pruning wounds, including shoot dieback and wedge-shaped wood discolorations observed in cross section, were among the most prevalent symptoms of the vines. To identify the causal agents, symptomatic woody tissues were surface disinfested with 95% ethanol and flame-sterilized and the discolored outer bark was cut away. The internal tissues (0.5 cm2) were excised from cankers of vines and plated onto potato dextrose agar amended with tetracycline (0.01%) (PDA-tet). The most frequently isolated fungi, based on general growth pattern, speed of growth, and colony color, resembled species in the Botryosphaeriaceae family. According to morphological characteristics, four different groups have been identified based on visual discrimination. After DNA extraction, ribosomal DNA fragments (ITS1-5.8S-ITS2) (2) amplified with ITS4 and ITS5 primers were sequenced and sequences were compared with those deposited in NCBI GenBank database. Four different Botryosphaeriaceae isolates were identified, including Botryosphaeria dothidea (MBAi25AG), Diplodia seriata (MBAi23AG), Lasiodiplodia theobromae (MBAi28AG), and Neofusicoccum parvum (MBAi27AG) (Accession Nos. KF182329, KF182328, KF182331, and KF182330, respectively) with species nomenclature based on Crous et al. (1). Pathogenicity tests were conducted under greenhouse conditions (24°C, 16/8-h day/night, 70% RH) on 1-year-old own rooted grapevine (Vitis vinifera) cv. Sultana Seedless seedlings using one isolate from each of the Botryosphaeriaceae species specified above. Stems of grapevine seedlings were wounded by removing bark with 4-mm cork borer and fresh mycelial plugs were inoculated into the holes and covered with Parafilm. Sterile PDA plugs were placed into the wounds of control seedlings. Five vines were inoculated per isolate. The experiment was repeated twice. After 4 months of incubation, grapevine seedlings were examined for the extent of vascular discoloration and recovery of fungal isolates. Mean lesion lengths on wood tissues were 85.3, 17.2, 13.9, and 13.1 mm for N. parvum, B. dothidea, L. theobromae, and D. seriata, and 6.3 mm for control. Each fungal isolate was successfully re-isolated from inoculated seedlings to fulfill Koch's postulates. To our knowledge, this is the first report of multiple species in the Botryosphaeriaceae causing wood canker and dieback on grapevine in Turkey. These results are significant because Botryosphaeriaceae species are known causal agents of grapevine trunk disease worldwide (3). References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) B. Slippers et al. Mycologia 96:83, 2004. (3) J. R. Urbez-Torres. Phytopathol. Mediterr. 50:S5, 2011.

Download Full-text

First Report of Cladobotryum protrusum causing Cobweb Disease on the Edible Mushroom Coprinus comatus

Plant Disease ◽

10.1094/pdis-07-14-0757-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 287-287 ◽

Cited By ~ 6

Author(s):

G. Z. Wang ◽

M. P. Guo ◽

Y. B. Bian

Keyword(s):

Fruiting Body ◽

Morphological Characteristics ◽

Edible Mushroom ◽

Its2 Region ◽

Pathogenicity Test ◽

Distilled Water ◽

Fruiting Bodies ◽

Coprinus Comatus ◽

First Report ◽

Medicinal Value

Coprinus comatus is one of the most commercially important mushrooms in China. Its fruiting body possesses rich nutritional and medicinal value. In November 2013, unusual symptoms were observed on C. comatus on a mushroom farm in Wuhan, Hubei, China. At first, fruiting bodies were covered by white and cobweb-like mycelia. Later, the cap and stipe turned brown or dark before rotting and cracking. The pathogen was isolated from infected tissue of C. comatus. Colonies of the pathogen on potato dextrose agar (PDA) medium first appeared yellowish, followed by an obvious ochraceous or pinkish color. Aerial mycelia grew along the plate wall, cottony, 1 to 4 mm high. Conidiophores were borne on the tops of hyphae, had two to four branches, and were cylindrical, long clavate, or fusiform. Conidia were borne on the tops of the branches of conidiophores, had one to two separates, and were long and clavate. The spores ranged from 15.3 to 22.1 μm long and were 5.1 to 8.3 μm wide, which was consistent with the characteristics of Cladobotryum protrusum (1). The species was identified by ribosomal internal transcribed spacer sequencing. The ribosomal ITS1-5.8S-ITS2 region was amplified from the isolated strain using primers ITS1 and ITS4. A BLAST search in GenBank revealed the highest similarity (99%) to C. protrusum (GenBank Accession Nos. FN859408.1 and FN859413.1). The pathogen was grown on PDA at 25°C for 3 days, and the inoculation suspension was prepared by flooding the agar surface with sterilized double-distilled water for spore suspension (1 × 105 conidia/ml). In one treatment, the suspension was sprayed on casing soil (106 conidia/m2) and mixed thoroughly with it, then cased with treated soil for 2 to 3 cm thickness on the surface of compost in cultivation pots (35 × 25× 12 cm), with sterile distilled water as a control (2). Eight biological replicates were included in this treatment. In the second treatment, mycelia plugs (0.3 × 0.3 cm) without spore production were added to 20 fruiting bodies. Mushrooms treated with blank agar plugs (0.3 × 0.3 cm) were used as a control. The plugs were covered with sterilized cotton balls to avoid loss of moisture. Tested cultivation pots were maintained at 18°C and 85 to 95% relative humidity. In the samples where casing soil was sprayed with conidia suspension, white mildew developed on the pileus, and a young fruiting body grew out from the casing soil. Eventually, the surface of the mushroom was overwhelmed by the mycelia of the pathogen and the pileus turned brown or black. For the other group inoculated with mycelia plugs, only the stipe and pileus inoculated with mycelia turned brown or dark; it rotted and cracked 2 to 3 days later. The symptoms were similar to those observed on the C. comatus cultivation farm. Pathogens re-isolated from pathogenic fruiting bodies were confirmed to be C. protrusum based on morphological characteristics and ITS sequence. To our knowledge, this is the first report of the occurrence of C. protrusum on the edible mushroom C. comatus (3). Based on the pathogenicity test results, C. protrusum has the ability to severely infect the fruiting body of C. comatus. References: (1) K. Põldmaa. Stud. Mycol. 68:1, 2011. (2) F. J. Gea et al. Plant Dis. 96:1067, 2012. (3) W. H. Dong et al. Plant Dis. 97:1507, 2013.

Download Full-text

First Report of Branch Blight of Tree Peony Caused by Phoma glomerata in China

Plant Disease ◽

10.1094/pdis-12-12-1129-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1114-1114 ◽

Cited By ~ 4

Author(s):

D. Zhao ◽

Y. B. Kang

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Its2 Region ◽

Tree Peony ◽

Disease Symptoms ◽

First Report ◽

Plastic Bag ◽

Pure Cultures ◽

Branch Dieback

Tree peony (Paeonia suffruticosa Andrews) is a perennial woody deciduous shrub native to China and famous for its beautiful flowers. Starting in early autumn 2010, blighted branches of tree peony were detected in the International Peony Garden in Luoyang. The disease incidence was greater than 10% and disease symptoms included bulb atrophy and twig and branch dieback. Pycnidia were embedded within the bark of diseased branches. They were small, black, ostiolate, and measured 145 to 275 × 140 to 251 μm. Pycnoconidia were single-celled, hyaline or sandy beige, rounded to ellipsoidal, and 3.9 to 10.3 × 2.3 to 7.0 μm. Pure cultures were obtained by plating the pycnoconidia on potato dextrose agar (PDA). In culture, the fungus produced a circular, white to pink colony with pyknotic and linter shaped aerial mycelium. Numerous pycnidia, initially brown and dark at maturity, were embedded in the mycelium, especially in the center of the colony, with a few of them scattered in the edge. The morphological characteristics were consistent with Phoma (2). The ITS1-5.8S-ITS2 region of three isolates were PCR amplified and sequenced with primers ITS1 and ITS4. Sequences (GenBank Accession No. JX885584) showed 99% identity with reference isolates of Peyronellaea glomerata (Corda) Goid (AB470906.1 and HQ380779.1) and Phoma glomerata (Corda) Wollenw. & Hochapfel (EU098115.1). These two species are synonyms (1). To test pathogenicity, nine healthy branches of 3-year-old potted tree peony plants were wound-inoculated with a PDA disk containing pycnidia from an actively growing colony of P. glomerata. Three control branches were inoculated with sterile PDA disks. Each inoculated branch was wrapped in a plastic bag and maintained in a greenhouse at 25 to 28°C. After 3 days, brown patches appeared on inoculated branches and extended by up to 1 cm. Pycnidia identical to those observed in the field and in storage appeared on all inoculated branches 7 days after inoculation. Control branches did not show symptoms. The pathogen was reisolated from inoculated branches, fulfilling Koch's postulates. P. glomerata was reported as the causal agent of withering of flowers and young shoots of grapevines in Yugoslavia (3). To our knowledge, P. glomerata and Botryosphaeria dothidea have always been reported together, causing branch wilting or dieback. To our knowledge, this is the first report of branch blight of tree peony caused by P. glomerata in China. References: (1) M. M. Aveskamp et al. Mycol. Soc. Am. 101:363, 2009. (2) G. H. Boerema et al. Studies in Mycology, 3, 1973. (3) A. Šaric-Sabadoš et al. Atti Ist. bot. Univ. Pavia 18:101, 1960.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽

10.1094/pdis-05-21-1123-pdn ◽

2021 ◽

Author(s):

Sixto Velarde Felix ◽

Victor Valenzuela ◽

Pedro Ortega ◽

Gustavo Fierros ◽

Pedro Rojas ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Species Complex ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

Download Full-text

First report of panicle rot caused by Fusarium asiaticum on foxtail millet in China

Plant Disease ◽

10.1094/pdis-04-21-0856-pdn ◽

2021 ◽

Author(s):

Fanxin Kong ◽

Haijin Zhang ◽

Zhi Liu ◽

Guoqiu Chen ◽

Jing Xu

Keyword(s):

Foxtail Millet ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Its Region ◽

Liaoning Province ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Dark Cycle ◽

First Report ◽

Fusarium Asiaticum

Foxtail millet [ Setaria italica (L.) P. Beauv.] is one of the most important nutritious food crops. It is used for wine and health products in China. In August of 2019, panicle rot symptoms with up to 85% of panicles infected were observed on foxtail millet (cultivar Chaogu 8) in a commercial field located in Chaoyang city of Liaoning Province, China. Typical disease symptoms included brown spots on spikelets at early stages and brown-colored withering and rot of whole panicles at late stages, with the symptoms being more severe at the tip of the panicles. Under high humidity conditions, pink or salmon-colored molds developed on panicles. Symptomatic spikelet pieces were surface-disinfested with 70% ethanol for 1 min followed by 2% NaOCl for 3 min, rinsed with sterilized water for three times, and placed on potato dextrose agar (PDA) medium at 25°C. After 5 days, colonies turned pink to dark red with fluffy aerial mycelium and pigmentation with the age. Ten pure cultures were obtained from single conidia of mycelium grown on carnation leaf agar (CLA) medium at 25°C under a 12-h light-dark cycle using an inoculation needle under stereomicroscope. Macroconidia were hyaline, falcate with foot cells, 3–5 septate and size: 28.5- 44.0 μm × 3.8 - 4.9 μm. Chlamydospores were globose to subglobose (5.4 to 13.8 μm). No microconidia were produced on CLA. Black, ostiolate subglobose perithecia were formed on CLA after one month of incubation at 20°C under a 12-h light-dark cycle. Morphological characteristics of the fungus were in agreement with the description of Fusarium asiaticum (O’Donnell et al. 2004; Leslie and Summerell 2006). To validate this identification, partial translation elongation factor 1 alpha (TEF1-a) gene, and rDNA internal transcribed spacer (ITS) region of five isolates were amplified and sequenced (O’Donnell et al. 2015; White et al.1990). Identical sequences were obtained, and the sequence of one representative isolate (JGF-3) was submitted to GenBank. BLASTn analysis of both TEF sequence (MW685833) and ITS sequence (MW423687), revealed 100% sequence identity with F. asiaticum KT380120 and MT322117, respectively. Pathogenicity test were conducted on cultivar Chaogu 8 of foxtail millet. Inoculum was prepared from the culture of JGF-3 incubated in 2% mung beans juice on a shaker (140 rpm) at 25°C for 48 h. Conidial suspension (5 × 105 conidia per ml) was prepared and sprayed onto the panicles of 20 plants at the initial flowering stage and 20 additional plants that were sprayed with distilled water served as the non-inoculated controls. Treated plants were covered with plastic bags for 48 h and maintained at a greenhouse with day and night temperatures of 26 and 24°C, respectively. Two weeks after inoculation, all inoculated panicles exhibited symptoms similar to the syptoms observed in the field. No symptoms were observed in the non-inoculated control plants. The experiment was repeated twice with similar results. F. asiaticum was reisolated from the inoculated plants and its morphological characteristics matched those of the original isolates; the fungus was not reisolated from the non-inoculated plants. To our knowledge, this is the first report of F. asiaticum causing panicle rot of foxtail millet in China. To date, the disease has been observed to be present in Fuxin and Tieling city of Liaoning Province. Panicle rot can become an important disease in foxtail millet in China. References: O’Donnell, K., et al. 2004. Fungal Genetics and Biology 41: 600. Leslie, J. F., and Summerell, B. A. 2006. The Fusarium laboratory manual. Blackwell Publishing, Ames, pp 176-179. O’ Donnell, K., et al. 2015. Phytoparasitica 43: 583. White, T. J., et al. 1990. Academic Press, San Diego, CA, pp 315-322.

Download Full-text

First Report of Dieback Disease on Cedars Caused by Diplodia seriata in China

Plant Disease ◽

10.1094/pdis-03-14-0309-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1279-1279 ◽

Cited By ~ 3

Author(s):

Z. J. Jiao ◽

Y. C. Kan ◽

S. L. Huang

Keyword(s):

Morphological Characteristics ◽

Its Sequences ◽

Fluorescent Light ◽

Foeniculum Vulgare ◽

Diplodia Seriata ◽

First Report ◽

Rdna Its ◽

Rdna Its Sequences ◽

Dieback Disease ◽

Pinus Spp

Cedars (Cedrus deodara (Roxb.) G. Don) are well known as evergreen ornamental trees widely used in horticulture in temperate climates. In March 2013, dieback symptoms were found on cedar trees in different locations (including the campus of Nanyang Normal University) in Nanyang (33°01′ N, 112°29′ E), a southwestern city of Henan Province, China. Characteristic symptoms included needle discoloration and defoliation, canker formation and gummosis on trunks and branches, browning and tissue necrosis under the bark as well as dieback of branches/trunks. Of 873 cedar trees investigated, 139 (16%) were symptomatic. A total of 21 Diplodia sp. isolates were obtained from 102 tissue pieces randomly sampled from the lesion margins of 31 affected trees with a conventional method for isolation of culturable fungal species from plant tissues. Monohyphal cultures were isolated from actively growing edges of colonies to purify the isolates. The purified isolates were grown on 2% water agar with sterilized stems of Foeniculum vulgare to induce their colonies to form pycnidia (4). Unmatured conidia were hyaline, aseptate, and turned light to dark brown with maturity. Mature conidia were aseptate (rarely uniseptate), ovoid with truncated or rounded base and obtuse apex, externally smooth, roughened on the inner surface, and 8 to 11 × 23 to 26 μm (n = 50). These morphological characteristics of the isolates agreed with those of Diplodia seriata (the anamorph of Botryosphaeria obtusa) (5). The rDNA-ITS sequences of two representative isolates (xs-01 and xs-06) were amplified with primers ITS1 and ITS4. PCR products were purified and ligated with PMD-19T vector for sequencing. The rDNA-ITS sequences were submitted to GenBank with accession nos. KJ463386 and KJ549774 for isolates xs-01 and xs-06, respectively, showing 100% identity with multiple isolates of D. seriata (HQ660463, KC461297, and KF535906). Koch's postulates were fulfilled in greenhouse tests on 2-year-old cedar plantlets inoculated by the two isolates. Ten plantlets were used for the inoculation tests for each of the isolates, and their trunks were wounded to a 2 mm depth with a sterilized cork borer (3 mm diameter). The wounds were inoculated by mycelial plugs cut from 7-day-old colonies grown on potato dextrose agar (PDA) plates and wrapped with Parafilm, and those inoculated with pure PDA plugs served as control. Inoculated plantlets were incubated in a greenhouse with alternating cycles of 14 h fluorescent light/10 h darkness under moist conditions for 30 to 60 days at 28°C. Nine of 20 inoculated plantlets developed needle discoloration and shoot blight symptoms similar to those observed on naturally infected cedar trees. The control plantlets remained symptomless during the incubation period. D. seriata cultures were constantly recovered from each diseased plantlet, indicating that the isolated D. seriata isolates were responsible for the disease. D. seriata has been reported as a phytopathogen causing dieback diseases worldwide on multiple woody plant species such as olive (4), mulberry (1), Pinus spp., and Picea glauca (2,3). To our knowledge, this is the first report of D. seriata causing dieback disease on cedars in China. References: (1) M. Arzanlou et al. Arch. Phytopathol. Plant Protect. 46:682, 2013. (2) T. Burgess et al. Appl. Environ. Microbiol. 67:354, 2001. (3) G. Hausner et al. Can. J. Plant Pathol. 21:256, 1999. (4) J. Kaliterna et al. Plant Dis. 96:290, 2012. (5) A. J. L. Phillips et al. Fungal Divers. 25:141, 2007.

Download Full-text

First report of late blight caused by Phytophthora infestans in potato in Tibet Autonomous Region of China

Plant Disease ◽

10.1094/pdis-08-21-1660-pdn ◽

2021 ◽

Author(s):

Dongfeng Guo ◽

Linhan Li ◽

Zhen Lei ◽

Yue Zhang ◽

Lixuan Meng ◽

...

Keyword(s):

Late Blight ◽

Phytophthora Infestans ◽

Dna Sequence ◽

Morphological Characteristics ◽

Its2 Region ◽

Pathogenicity Test ◽

Potato Field ◽

Autonomous Region ◽

First Report ◽

Tibet Autonomous Region

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world’s highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar ‘Longshu 10’ with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5’GGCCTTGACGACATCCAGAA3’; EF_R: 5’TAGCAGCTCAACCCGAAGTG3’), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5’TTCCCTTTGTCCTCTACCGAT3’; P2R: 5’TTACGGCGGTTTAGCACATACA3’) (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. ‘Favorita’ for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. ‘Favorita’ with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

Download Full-text

First Report of Fruit Rot in Pear Caused by Botryosphaeria dothidea in Italy

Plant Disease ◽

10.1094/pdis-02-12-0130-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 910-910 ◽

Cited By ~ 9

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

The United States ◽

Fruit Rot ◽

Pathogenicity Test ◽

Botryosphaeria Dothidea ◽

First Report ◽

Irregular Margin ◽

Pyrus Communis L ◽

Pathogenicity Tests

Pear (Pyrus communis L.) is widely grown in Italy, the leading producer in Europe. In summer 2011, a previously unknown rot was observed on fruit of an old cultivar, Spadoncina, in a garden in Torino Province (northern Italy). The decayed area of the fruit was soft, dark brown, slightly sunken, circular, and surrounded by an irregular margin. The internal decayed area appeared rotten and brown and rotted fruit eventually fell. To isolate the causal agent, fruits were soaked in 1% NaOCl for 30 s and fragments (approximately 2 mm) were taken from the margin of the internal diseased tissues, cultured on potato dextrose agar (PDA), and incubated at temperatures between 20 and 28°C under alternating light and darkness. Colonies of the fungus initially appeared whitish, then turned dark gray. After about 30 days of growth, unicellular elliptical hyaline conidia were produced in pycnidia. Conidia measured 16 to 24 × 5 to 7 (average 20.1 × 5.7) μm (n = 50). The morphological characteristics are similar to those of the fungus Botryosphaeria dothidea (Moug.: Fr.) Ces. & De Not. (4). The internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. BLAST analysis (1) of the 473-bp segment showed a 100% similarity with the sequence of the epitype of B. dothidea AY236949. The nucleotide sequence has been assigned the GenBank Accession No. JQ418493. Pathogenicity tests were performed by inoculating six pear fruits of the same cultivar (Spadoncina) after surface disinfesting in 1% sodium hypochlorite and wounding. Mycelial disks (8 mm diameter), obtained from 10-day-old PDA cultures of one strain, were placed on wounds. Six control fruits were inoculated with plain PDA. Fruits were incubated at 25 ± 1°C in plastic boxes. The first symptoms developed 3 days after inoculation. After 5 days, the rot was very evident and B. dothidea was consistently reisolated. Noninoculated fruits remained healthy. The pathogenicity test was performed twice. B. dothidea was identified on decayed pears in the United States (2), South Africa, New Zealand, Japan, and Taiwan (3). To our knowledge, this is the first report of the presence of B. dothidea on pear in Italy, as well as in Europe. In Italy, the economic importance of the disease on pear fruit is at present limited, although the pathogen could represent a risk for this crop. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) L. F. Grand. Agr. Res. Serv. Techn. Bull. 240:1, 1985. (3) Y. Ko et al. Plant Prot. Bull. (Taiwan) 35:211, 1993. (4) B. Slippers et al. Mycologia 96:83, 2004.

Download Full-text

First Report of Lasiodiplodia theobromae Causing Branch Dieback on Castor Bean in Zhanjiang, China

Plant Disease ◽

10.1094/pdis-08-20-1723-pdn ◽

2021 ◽

Author(s):

Jian Rong Tang ◽

Yue Lian Liu ◽

Xue Gui Yin ◽

Jian Nong Lu ◽

Yu Han Zhou

Keyword(s):

Castor Bean ◽

Ricinus Communis ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Molecular Data ◽

Pathogenicity Test ◽

First Report ◽

Branch Dieback ◽

Β Tubulin

Castor bean (Ricinus communis L.) is an oil crop of significant economic importance in the industry and medicine. In August 2019, a branch dieback disease was observed on castor bean in a field in Zhanjiang (21.17°N, 110.18°E), China. The incidence rate was 35% (n=600 investigated plants). Symptoms were discoloration of leaves, branch dieback, and discoloration of internal stem tissues. The disease had spread to the whole branches and causing the plant to die. Seven diseased branches were collected from seven plants. Margins between healthy and diseased tissues were cut into 2 mm × 2 mm pieces. The surfaces were disinfested with 75% ethanol for 30 s and 2% sodium hypochlorite for 60 s. Then, the samples were rinsed thrice in sterile water, placed on PDA, and incubated at 28 °C. Pure cultures were obtained by transferring the hyphal tips to new PDA plates. Eighteen isolates were obtained (the isolate rate of 75%), which were the same fungus on the basis of morphological characteristics and molecular analysis of the internal transcribed spacer (ITS). A single representative isolate (RiB-1) was used for further study. The colony of RiB-1 was 5 cm in diameter on the 5th day on the PDA culture. The colony was greenish gray with an irregularly distributed and fluffy aerial mycelium, which turned black after 10 days. The mature conidia were 21.3–26.5 µm × 12.2–15.7 µm in size (n=100) and had two ovoid, dark brown cells with longitudinal striations. The morphological characteristics of the colonies were consistent with the description of Lasiodiplodia sp. (Alves et al. 2008). Three regions of the ITS, translation elongation factor (EF1-α), and β-tubulin genes were amplified and sequenced with the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Alves et al. 2008), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. The resulting sequences were deposited in the GenBank under accession numbers MN759432 (ITS), MN719125 (EF1-α), and MN719128 (β-tubulin). BLASTn analysis demonstrated that these sequences were 100% identical to the corresponding ITS (MK530052), EF1-α (MK423878), and β-tubulin (MN172230) sequences of L. theobromae. Based on the morphological and molecular data, RiB-1 was determined as L. theobromae. A pathogenicity test was performed in a greenhouse with 80% relative humidity at 25 °C to 30 °C. Ten healthy plants of Zi Bi No. 5 castor bean (1-month-old) were grown in pots with one plant in each pot. Five pots were wound-inoculated with 5-mm-diameter mycelial plugs obtained from 7-day cultures. Five additional pots treated with PDA plugs served as the controls. Inoculated stems were moisturized with sterile cotton for five days. The test was conducted three times. Disease symptoms, similar to those in the field, were observed on the inoculated plants two weeks after inoculation, and L. theobromae was 100% reisolated from the inoculated plants. The control plants remained symptomless, and reisolations were unsuccessful. These results consistent with Koch’s postulates. L. theobromae (Lima et al. 1997) and L. hormozganensis (Fábio et al. 2018) had been reported to cause stem rot on castor bean in Brazil, but whether L. theobromae caused the branch dieback on castor bean in China has not been reported yet. Thus, this study is the first report of L. theobromae causing the branch dieback on castor bean in Zhanjiang, China. This study provides an important reference for the control of the disease.

Download Full-text

First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽

10.1094/pdis-03-21-0631-pdn ◽

2021 ◽

Author(s):

Charles Krasnow ◽

Nancy Rechcigl ◽

Jennifer Olson ◽

Linus Schmitz ◽

Steven N. Jeffers

Keyword(s):

United States ◽

South Carolina ◽

Sequence Similarity ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Broad Host Range ◽

Pathogenicity Test ◽

First Report ◽

Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

Download Full-text