First Report of a Begomovirus Associated with Tomato Yellow Leaf Curl Disease in Ethiopia

During December 2003, severe leaf yellowing, leaf curling, and stunting symptoms were observed in tomato (Lycopersicon esculentum) plantings in Melkassa (1,550 m above sea level), Ethiopia. Eleven symptomatic samples were collected and tested for the presence of a begomovirus using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3). Samples were also tested for Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tobacco etch virus (TEV), Pepper veinal mottle virus (PVMV), and Tomato mosaic virus (ToMV) using enzyme-linked immunosorbent assay (ELISA). All samples were negative for CMV, PVY, TEV, PVMV, and ToMV. However, the expected 1.4-kb PCR product for begomoviruses was obtained from all samples. DNA-B and DNA-beta were not detectable using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/ DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. The 1.4-kb PCR product of one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,785 nucleotides (GenBank Accession No. DQ358913) and was found to contain the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The DNA-A sequence of the virus associated with yellow leaf curl disease of tomato from Ethiopia showed highest sequence identity (92%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accession No. AY502934). On the basis of the DNA-A sequence comparison and the ICTV demarcation of species at 89% sequence identity, the Ethiopian virus is a provisional strain of TYLCMLV described from Mali. To our knowledge, this is the first report of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

First Report of Tobacco as a Natural Host of Tomato yellow leaf curl virus in Spain

Plant Disease ◽

10.1094/pd-89-0910b ◽

2005 ◽

Vol 89 (8) ◽

pp. 910-910 ◽

Cited By ~ 5

Author(s):

M. I. Font ◽

C. Córdoba ◽

A. García ◽

R. Santiago ◽

C. Jordá

Keyword(s):

Mosaic Virus ◽

Simultaneous Detection ◽

Tomato Yellow Leaf ◽

Natural Host ◽

Enzyme Linked Immunosorbent Assay ◽

Yellow Leaf ◽

Tobacco Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Two begomovirus species, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), have been identified as causal agents of tomato yellow leaf curl disease (TYLCD) in Spain. TYLCSV was reported in Spain in 1992 and TYLCV in 1997 on tomato crops (3). TYLCV was also reported in common bean (Phaseolus vulgaris L.) and pepper (Capsicum annuum L.) crops in southern Spain in 1997 and 1999, respectively. During the summer of 2004, symptoms of yellowing, crumpling, and necrosis of new leaves were observed sporadically in young, field-grown tobacco (Nicotiana tabacum L.) plants in the Badajoz Province. These tobacco plants were next to tomato crops where TYLCV was detected for the first time in Badajoz in 2003. In September 2004, four symptomatic tobacco plants were selected for double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) and polymerase chain reaction (PCR) identification analyses. Serological analyses were carried out in two repetitions and with the following polyclonal antisera: Potato virus Y (PVY) (Loewe Biochemica, Sauerlach, Germany); Tobacco mild green mosaic virus (produced in our laboratory); Tobacco mosaic virus (BIO-RAD, Marnes-La-Coquette, France); and Tomato spotted wilt virus (Loewe Biochemica). A simplified method of duplex PCR was used for a rapid, sensitive, and simultaneous detection of TYLCSV and TYLCV (2). Mixed infections of PVY and TYLCV were detected in all four tobacco samples tested. TYLCV infection was confirmed using the primer pair TY-1/TY-2 specific for the coat protein (CP) gene of begomoviruses (1). The CP fragment was digested with the restriction enzyme AvaII, and the pattern obtained corresponded to that obtained from TYLCV-infected tomato that served as a positive control. Two PCR products from different tobacco samples were sequenced and both showed 100% identity with the corresponding region (Almería) of TYLCV (GenBank Accession No. AJ489258) and 99% with TYLCV-Mild (Spain) (GenBank Accession No. AJ519441), confirming the diagnosis. The symptoms observed in the tobacco plants can not be attributed solely to TYLCV since the virus was present in a mixed infection with PVY. However, tobacco infected with TYLCV may serve as an important alternate host for TYLCV in the tomato cropping system. To our knowledge, this is the first report of N. tabacum as a natural host of TYLCV in Spain. References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) P. Martínez-Culebras et al. Ann. Appl. Biol. 139:251, 2001. (3) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus

Chinese Journal of Agricultural Biotechnology ◽

10.1017/s1479236207001611 ◽

2007 ◽

Vol 4 (2) ◽

pp. 127-131 ◽

Cited By ~ 3

Author(s):

He Zi-Fu ◽

Yu Hao ◽

Mao Ming-Jie ◽

Luo Fang-Fang ◽

Lin Yi-Han ◽

...

Keyword(s):

Intergenic Region ◽

Virus Isolate ◽

Tomato Yellow Leaf ◽

Tomato Leaf ◽

Yellow Leaf ◽

Sequence Identity ◽

Begomovirus Genome ◽

Tomato Leaf Curl ◽

Leaf Curl Disease ◽

Leaf Curl

AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽

10.1094/pdis.1999.83.3.303b ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 22

Author(s):

M. Peterschmitt ◽

M. Granier ◽

R. Mekdoud ◽

A. Dalmon ◽

O. Gambin ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Eustoma (Eustoma grandiflorum) in Korea

Plant Disease ◽

10.1094/pdis-02-14-0162-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1163-1163 ◽

Cited By ~ 3

Author(s):

E.-J. Kil ◽

H.-S. Byun ◽

S. Kim ◽

H. Hwang ◽

M.-K. Kim ◽

...

Keyword(s):

Mosaic Virus ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Dna Fragments ◽

Viral Dna ◽

Eustoma Grandiflorum ◽

First Report ◽

Leaf Curling ◽

Leaf Curl Virus ◽

Leaf Curl

Eustoma (Eustoma grandiflorum), also called lisianthus, belongs to the family Gentianaceae and is cultivated for flower production globally (1), including in Korea. At least 10 viruses can infect eustoma, including Cucumber mosaic virus (genus Cucumovirus), Tobacco mosaic virus (genus Tobamovirus), Tomato spotted wilt virus (genus Tospovirus), and Tomato yellow leaf curl virus (TYLCV, genus Begomovirus) (1,2). In December 2012, disease symptoms such as leaf curling and stunting were observed on eustoma plants grown in Gumi, Korea, where TYLCV outbreak was reported on tomato farms. In a eustoma greenhouse, about 5% of eustoma plants showed the leaf curling and stunting symptoms. Total DNA was isolated from 15 symptomatic eustoma plants with a Viral Gene-spin Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea) and viral DNA was amplified by rolling circle amplification (TempliPhi Amplification Kit, GE Healthcare Life Sciences, Uppsala, Sweden) following the manufacturer's instructions. All amplicons were digested with the restriction enzyme SacI (TaKaRa Bio, Shiga, Japan) and 2.8-kb DNA fragments were verified on an agarose gel. Fifteen digested DNA fragments were purified from the gel, ligated into pGEM-T easy vector (Promega, Madison, WI), and sequenced (Macrogen, Seoul, Korea, GenBank Accession No. KF225312.1). A BLAST search exhibited a 99% identity to TYLCV previously reported in Korea (GenBank HM856911.1). This is the first report of TYLCV in eustoma plants in Korea. To identify the movement and replication of TYLCV in infected eustoma plants, PCR and Southern hybridization analysis were performed with samples from four organs (flower, leaf, stem, and root) of three individual TYLCV-infected plants. TYLCV TYL DNA from each organ sample was amplified using 2× Taq PCR MasterMix (Bioneer, Daejeon, Korea) with TYLCV-specific primers (TYLCV-F: 5′-ATATTACCGGATGGCCGCGCCT-3′, CV-R: 5′-TCCACGGGGAACATCAGGGCTT-3′). Single-stranded as well as double-stranded TYLCV DNA were identified from all organs of symptomatic eustoma, indicating TYLCV can replicate and move systemically in eustoma plants. Whitefly (Bemisia tabaci)-mediated plant-to-plant viral transmission was performed with one TYLCV-infected eustoma plant and five healthy eustoma plants and revealed that 80% (4 of 5) of the eustoma plants were infected by whitefly-mediated transmission. These results indicate that TYLCV-infected eustoma plants could act as virus reservoirs to healthy eustoma plants as well as other potential TYLCV hosts, such as tomatoes. In Korea, TYLCV has been the most notorious plant virus since 2008 (3), but, until now, TYLCV infection in eustoma plants has not been reported in Korea. References: (1) C. C. Chen et al. Plant Dis. 84:506, 2000. (2) A. Kritzman et al. Plant Dis. 84:1185, 2000. (3) H. Lee et al. Mol. Cells 30:467, 2010.

Download Full-text

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan

Plant Disease ◽

10.1094/pdis-94-5-0637b ◽

2010 ◽

Vol 94 (5) ◽

pp. 637-637 ◽

Cited By ~ 11

Author(s):

S. L. Shih ◽

W. S. Tsai ◽

L. M. Lee ◽

J. T. Wang ◽

S. K. Green ◽

...

Keyword(s):

Sequence Comparison ◽

Nucleotide Sequence Identity ◽

Disease Incidence ◽

Tomato Yellow Leaf ◽

Open Reading Frames ◽

Yellow Leaf ◽

Sequence Identity ◽

Pcr Product ◽

Reading Frames ◽

Leaf Curl

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum ‘Early Calwonder’ by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California

Plant Disease ◽

10.1094/pdis-91-8-1056a ◽

2007 ◽

Vol 91 (8) ◽

pp. 1056-1056 ◽

Cited By ~ 23

Author(s):

M. R. Rojas ◽

T. Kon ◽

E. T. Natwick ◽

J. E. Polston ◽

F. Akad ◽

...

Keyword(s):

Sequence Analysis ◽

Tomato Yellow Leaf ◽

Tomato Leaf ◽

Homologous Sequence ◽

Yellow Leaf ◽

First Report ◽

Bona Fide ◽

Leaf Curl Virus ◽

Leaf Curl Disease ◽

Leaf Curl

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

Download Full-text

Molecular Characterization of Begomoviruses Associated with Leafcurl Diseases of Tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam

Plant Disease ◽

10.1094/pdis.2001.85.12.1286a ◽

2001 ◽

Vol 85 (12) ◽

pp. 1286-1286 ◽

Cited By ~ 27

Author(s):

S. K. Green ◽

W. S. Tsai ◽

S. L. Shih ◽

L. L. Black ◽

A. Rezaian ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Degenerate Primer ◽

Computer Assisted ◽

Yellow Leaf ◽

Sequence Comparisons ◽

Sequence Identity ◽

Pcr Product ◽

Great Genetic Diversity ◽

Leaf Curl Virus ◽

Leaf Curl

Production of tomato (Lycopersicon esculentum) in Bangladesh, Malaysia, Myanmar, Vietnam, and Laos has been severely affected by yellow leaf curl disease. Tomato leaf samples were collected from symptomatic tomato plants from farmers' fields in the five countries from 1997 to 1999. DNA was extracted from all samples, four from Vietnam, two each from Malaysia, Laos, and Myanmar, and seven from Bangladesh. Virus DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v 1978/PAR1c 715(1), which amplifies the top part of DNA A. All samples gave the expected 1.4-kb PCR product. The PCR product of one sample per country was cloned and sequenced. Based on the sequences of the 1.4-kb DNA products amplified by the first primer pair, specific primers were designed to complete each of the DNA A sequences. Computer-assisted sequence comparisons were performed with begomovirus sequences available in the laboratory at the Asian Vegetable Research and Development Center, Shanhua, Tainan, and in the GenBank sequence database. The five DNA species resembled DNA A of begomoviruses. For the detection of DNA B two degenerate primer pairs were used, DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (DNABLC1: 5′-GTVAATGGRGTDCACTTCTG-3′, DNABLC2: 5′-RGTDCACTT CTGYARGATGC-3′, DNABLV2: 5′-GAGTAGTAGTGBAKGTTGCA-3′), which were specifically designed to amplify DNA B of Asian tomato geminiviruses. Only the virus associated with yellow leaf curl of tomato in Bangladesh was found to contain a DNA B component, which was detected with the DNABLC1/DNABLV2 primer pair. The DNA A sequence derived from the virus associated with tomato yellow leaf curl from Myanmar (GenBank Accession No. AF206674) showed highest sequence identity (94%) with tomato yellow leaf curl virus from Thailand (GenBank Accession No. X63015), suggesting that it is a closely related strain of this virus. The other four viruses were distinct begomoviruses, because their sequences shared less than 90% identity with known begomoviruses of tomato or other crops. The sequence derived from the virus associated with tomato yellow leaf curl from Vietnam (GenBank Accession No. AF264063) showed highest sequence identity (82%) with the virus associated with chili leaf curl from Malaysia (GenBank Accession No. AF414287), whereas the virus associated with yellow leaf curl symptoms in tomato in Bangladesh (GenBank Accession No. AF188481) had the highest sequence identity (88%) with a tobacco geminivirus from Yunnan, China (GenBank Accession No. AF240675). The sequence derived from the virus associated with tomato yellow leaf curl from Laos (GenBank Accession No. AF195782) had the highest sequence identity (88%) with the tomato begomovirus from Malaysia (GenBank Accession No. AF327436). This report provides further evidence of the great genetic diversity of tomato-infecting begomoviruses in Asia. Reference: M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text