scholarly journals First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1056-1056 ◽  
Author(s):  
M. R. Rojas ◽  
T. Kon ◽  
E. T. Natwick ◽  
J. E. Polston ◽  
F. Akad ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Homologous Sequence ◽  
Yellow Leaf ◽  
First Report ◽  
Bona Fide ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

scholarly journals First Report of a Novel Strain of Tomato yellow leaf curl virus Causing Yellow Leaf Curl Disease on Cluster Bean in Pakistan

Plant Disease ◽  
2017 ◽  
Vol 101 (6) ◽  
pp. 1071-1071 ◽  
Author(s):  
S. S. Zaidi ◽  
S. Shakir ◽  
M. Farooq ◽  
I. Amin ◽  
S. Mansoor
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Cluster Bean ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

scholarly journals Sequence Analysis and Classification of Apparent Recombinant Begomoviruses Infecting Tomato in the Nile and Mediterranean Basins

2005 ◽  
Vol 95 (5) ◽  
pp. 549-555 ◽  
Author(s):  
C. M. Fauquet ◽  
S. Sawyer ◽  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Sequence Analysis ◽  
Phylogenetic Relationships ◽  
Tomato Yellow Leaf ◽  
Viral Diseases ◽  
Yellow Leaf ◽  
Recombination Hotspots ◽  
Molecular Biodiversity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Numerous whitefly-transmitted viral diseases of tomato have emerged in countries around the Nile and Mediterranean Basins the last 20 years. These diseases are caused by monopartite geminiviruses (family Gemini viridae) belonging to the genus Begomovirus that probably resulted from numerous recombination events. The molecular biodiversity of these viruses was investigated to better appreciate the role and importance of recombination and to better clarify the phylogenetic relationships and classification of these viruses. The analysis partitioned the tomato-infecting begomoviruses from this region into two major clades, Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus. Phylogenetic and pairwise analyses together with an evaluation for gene conversion were performed from which taxonomic classification and virus biodiversity conclusions were drawn. Six recombination hotspots and three homogeneous zones within the genome were identified among the tomatoinfecting isolates and species examined here, suggesting that the recombination events identified were not random occurrences.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato Plant Flavonoids Increase Whitefly Resistance and Reduce Spread of Tomato yellow leaf curl virus

2019 ◽  
Author(s):  
Qixi Yao ◽  
Zhengke Peng ◽  
Hong Tong ◽  
Fengbo Yang ◽  
Gaoshan Xing ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Electrical Penetration Graph ◽  
Severe Damage ◽  
The World ◽  
New Varieties ◽  
Leaf Curl Virus ◽  
Phloem Feeding ◽  
Leaf Curl Disease ◽  
Leaf Curl

Abstract Tomato yellow leaf curl virus (TYLCV), a begomovirus (genus Begomovirus) is the causal agent of tomato yellow leaf curl disease (TYLCD), which causes severe damage to tomato (Solanum lycopersicum) crops throughout tropical and subtropical regions of the world. TYLCV is transmitted by the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) in a circulative and persistent manner. Our previous studies showed that tomato flavonoids deter B. tabaci oviposition, but the effects of tomato flavonoids on the settling and feeding behavior of B. tabaci and on its transmission of TYLCV are unknown. Using two near-isogenic tomato lines that differ greatly in flavonoid levels, we found that high flavonoid production in tomato deterred the landing and settling of B. tabaci. Moreover, electrical penetration graph studies indicated that high flavonoid levels in tomato reduced B. tabaci probing and phloem-feeding efficiency. As a consequence, high flavonoid levels in tomato reduced the primary and secondary spread of TYLCV. The results indicate that tomato flavonoids provide antixenosis resistance against B. tabaci and that the breeding of such resistance in new varieties could enhance TYLCD management.

scholarly journals First report of natural infection of tomato yellow leaf curl virus on cucumber in China

2020 ◽  
Vol 102 (4) ◽  
pp. 1371-1371
Author(s):  
Feng Zhu ◽  
Qin-Qin Zhang ◽  
Peng-Xiang Zhu ◽  
Qi-Ping Zhang ◽  
Meng-Yao Cao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Sign in / Sign up

Export Citation Format

Share Document