Urtica membranacea: A New Host for Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus in Italy

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

Download Full-text

A Mixed Infection of Lettuce chlorosis virus, Papaya ringspot virus, and Tomato yellow leaf curl virus-IL Detected in a Texas Papaya Orchard Affected by a Virus-Like Disease Outbreak

Plant Disease ◽

10.1094/pdis-01-17-0118-re ◽

2017 ◽

Vol 101 (7) ◽

pp. 1094-1102 ◽

Cited By ~ 5

Author(s):

Olufemi J. Alabi ◽

M. Al Rwahnih ◽

J. L. Jifon ◽

M. Sétamou ◽

J. K. Brown ◽

...

Keyword(s):

Pcr Amplification ◽

Host Record ◽

Tomato Yellow Leaf ◽

Ringspot Virus ◽

Yellow Leaf ◽

Papaya Ringspot Virus ◽

Perennial Crop ◽

New Host ◽

Leaf Curl Virus ◽

Leaf Curl

Severe virus-like symptoms consisting of mosaic, distortion, yellowing, and brittleness were observed on papaya plants in a 20-ha orchard in South Texas during the 2014–15 growing season. Incidence of symptomatic plants increased from ∼40 to 100% within 6 months of the outbreak; the most severely affected plants were stunted, and fruit yield and quality were reduced compared with asymptomatic plants. The orchard papaya plant virome was explored using the Illumina NextSeq 500 platform and results were validated by Sanger DNA sequencing of complete viral genomes obtained by PCR amplification. The combined results revealed the presence of Papaya ringspot virus (PRSV; Potyvirus), Lettuce chlorosis virus (LCV; Crinivirus), and Tomato yellow leaf curl virus-IL (TYLCV-IL; Begomovirus). The RT-PCR analyses of leaves from 51 randomly sampled papaya plants indicated the presence of PRSV, LCV, and TYLCV-IL in 100, 39.2, and 15.7% of the samples, respectively. Plants infected with PRSV, in combination with LCV and/or TYLCV-IL, exhibited more severe symptoms compared with plants infected with PRSV alone. Furthermore, successful whitefly-mediated transmission of TYLCV-IL and LCV was accomplished by exposing virus-free papaya seedlings to viruliferous Bemisia tabaci (Genn.) under greenhouse conditions. The results of this study document a new host record for LCV and the first successful whitefly-mediated transmission of TYLCV-IL and LCV to papaya. As a perennial crop, infected papaya serving as an over-seasoning reservoir for TYLCV-IL and LCV, presents a new challenge to viral disease management in papaya orchards.

Download Full-text

Solanum nigrum,a New Host of Tomato Yellow Leaf Curl Virus

Plant Disease ◽

10.1094/pd-65-979 ◽

1981 ◽

Vol 65 (12) ◽

pp. 979 ◽

Cited By ~ 2

Author(s):

K. I. Wilson

Keyword(s):

Tomato Yellow Leaf ◽

Solanum Nigrum ◽

Yellow Leaf ◽

New Host ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Control of the Bemisia tabaci/Tomato yellow leaf curl virus complex on protected tomato crops in Algarve (Portugal)*

EPPO Bulletin ◽

10.1046/j.1365-2338.2002.00558.x ◽

2002 ◽

Vol 32 (1) ◽

pp. 31-35

Author(s):

A. F. Arsenio ◽

E. Neto ◽

N. Ramos ◽

S. Mangerico ◽

E. Fortunato ◽

...

Keyword(s):

Bemisia Tabaci ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Virus Complex ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

Kartofel` i ovoshi ◽

10.25630/pav.2020.32.41.007 ◽

2020 ◽

pp. 30-34

Author(s):

С.Ф. Гавриш ◽

Т.А. Редичкина ◽

А.В. Буц ◽

Г.М. Артемьева

Keyword(s):

Resistance Genes ◽

Molecular Genetic Analysis ◽

Tomato Yellow Leaf ◽

Tomato Mosaic Virus ◽

Average Weight ◽

Yellow Leaf ◽

The South ◽

Economically Valuable Traits ◽

Leaf Curl Virus ◽

Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

Download Full-text