Cetyltrimethyl Ammonium Bromide (CTAB) DNA Miniprep for Plant DNA Isolation

2009 ◽  
Vol 2009 (3) ◽  
pp. pdb.prot5177-pdb.prot5177 ◽  
Author(s):  
J. D. Clarke
2019 ◽  
Vol 6 (2) ◽  
pp. 33
Author(s):  
Irvan R Hengkengbala ◽  
Grevo S Gerung ◽  
Stenly Wullur

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.


2016 ◽  
Vol 30 (32n33) ◽  
pp. 1650400 ◽  
Author(s):  
Yuanyuan Han ◽  
Dan Wang ◽  
Danyang Liang ◽  
Shiqi Wang ◽  
Guoxin Lu ◽  
...  

Scheelite (CaWO4)-type microphosphors were synthesized by the precipitation method assisted with cetyltrimethyl ammonium bromide (CTAB). All compounds crystallized in the tetragonal structure with space group [Formula: see text] (No. 88). FE-SEM micrographs illustrate the spherical-like morphologies and rough surface. PL spectra indicate the broad emission peak maximum at 613 nm under UV excitation. Luminescence decay curves monitored by [Formula: see text] transition ([Formula: see text] nm) of Eu[Formula: see text] in doped CaWO4 are presented, the curves exhibit a single-exponential feature and the lifetime for doped CaWO4 is 0.61 ms.


RSC Advances ◽  
2015 ◽  
Vol 5 (22) ◽  
pp. 17202-17209 ◽  
Author(s):  
Astakala Anil Kumar ◽  
Ashok Kumar ◽  
J. K. Quamara ◽  
G. R. Dillip ◽  
Sang Woo Joo ◽  
...  

Correlation between the structural, optical and dielectric behavior of Fe doped perovskite strontium stannate nanoparticles synthesized by a facile wet chemistry route.


Sign in / Sign up

Export Citation Format

Share Document