Stimulation of Cyclin-Dependent Kinase Activity and G1- to S-Phase Transition in Human Lymphocytes by the Human T-Cell Leukemia/Lymphotropic Virus Type 1 Tax Protein

ABSTRACT The human T-cell leukemia/lymphotropic virus type 1 (HTLV-1) induces a malignant lymphocytic disease. The HTLV-1 transactivator protein, Tax, is believed to be crucial for the development of the disease since it is transforming in vitro and induces tumors in transgenic animals. Although the transcriptional modulation of viral and cellular gene expression by Tax has been analyzed thoroughly, it has remained unclear how the Tax functions act on the cell cycle of primary T cells. To investigate the mechanism of Tax-mediated T-cell stimulation, we transduced primary human cord blood T cells with a conditional, tetracycline repressor-based tax expression system. Permanent Tax expression results in an abnormal proliferation of T cells which closely resemble HTLV-1-infected lymphocytes. Suppression of Tax synthesis stopped lymphocyte growth and caused cell cycle arrest in the G1 phase. Upon reinduction oftax expression, the arrested cells entered the S phase. This showed that Tax has mitogenic activity, which is required for stimulating the G1- to S-phase transition of immortalized lymphocytes. In mammalian cells, the G1-phase progression is controlled by the serial activation of several cyclin-dependent kinases (Cdks), starting with Cdk4 and Cdk6. In the presence of Tax, both Cdk4 and Cdk6 were activated. The suppression of Tax synthesis, however, resulted in a significant reduction of the Cdk4 and Cdk6 activities but did not influence the expression of Cdk4, Cdk6, or cognate D-type cyclin proteins. These data suggest that Tax induces Cdk4 and Cdk6 activity in primary human T lymphocytes; this Cdk activation is likely to account for the mitogenic Tax effect and for the abnormal T-cell proliferation of HTLV-1-infected lymphocytes.

Download Full-text

Human T-Cell Leukemia Virus Type 1 Infection Leads to Arrest in the G1 Phase of the Cell Cycle

Journal of Virology ◽

10.1128/jvi.00091-08 ◽

2008 ◽

Vol 82 (17) ◽

pp. 8442-8455 ◽

Cited By ~ 35

Author(s):

Meihong Liu ◽

Liangpeng Yang ◽

Ling Zhang ◽

Baoying Liu ◽

Randall Merling ◽

...

Keyword(s):

Cell Cycle ◽

T Cells ◽

T Cell ◽

Leukemia Virus ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Cell Leukemia Virus Type ◽

Human T Cell ◽

T Cell Leukemia Virus

ABSTRACT Infection by the human T-cell leukemia virus type 1 (HTLV-1) is thought to cause dysregulated T-cell proliferation, which in turn leads to adult T-cell leukemia/lymphoma. Early cellular changes after HTLV-1 infection have been difficult to study due to the poorly infectious nature of HTLV-1 and the need for cell-to-cell contact for HTLV-1 transmission. Using a series of reporter systems, we show that HeLa cells cease proliferation within one or two division cycles after infection by HTLV-1 or transduction of the HTLV-1 tax gene. HTLV-1-infected HeLa cells, like their tax-transduced counterparts, expressed high levels of p21 CIP1/WAF1 and p27 KIP1 , developed mitotic abnormalities, and became arrested in G1 in senescence. In contrast, cells of a human osteosarcoma lineage (HOS) continued to divide after HTLV-1 infection or Tax expression, albeit at a reduced growth rate and with mitotic aberrations. Unique to HOS cells is the dramatic reduction of p21 CIP1/WAF1 and p27 KIP1 expression, which is in part associated with the constitutive activation of the phosphatidylinositol-3-kinase (PI3K)-protein kinase B (Akt) pathway. The loss of p21 CIP1/WAF1 and p27 KIP1 in HOS cells apparently allows HTLV-1- and Tax-induced G1 arrest to be bypassed. Finally, HTLV-1 infection and Tax expression also cause human SupT1 T cells to arrest in the G1 phase of the cell cycle. These results suggest that productive HTLV-1 infection ordinarily leads to Tax-mediated G1 arrest. However, T cells containing somatic mutations that inactivate p21 CIP1/WAF1 and p27 KIP1 may continue to proliferate after HTLV-1 infection and Tax expression. These infected cells can expand clonally, accumulate additional chromosomal abnormalities, and progress to cancer.

Download Full-text

Ras signaling contributes to survival of human T-cell leukemia/lymphoma virus type 1 (HTLV-1) Tax-positive T-cells

APOPTOSIS ◽

10.1007/s10495-011-0676-z ◽

2011 ◽

Vol 17 (3) ◽

pp. 219-228 ◽

Cited By ~ 9

Author(s):

Giovanna Stoppa ◽

Enrica Rumiato ◽

Daniela Saggioro

Keyword(s):

T Cells ◽

T Cell ◽

Virus Type ◽

Ras Signaling ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Human T Cell

Download Full-text

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element

Blood ◽

10.1182/blood-2002-07-2301 ◽

2003 ◽

Vol 101 (9) ◽

pp. 3615-3621 ◽

Cited By ~ 37

Author(s):

Nozomu Hiraiwa ◽

Tomonori Yabuta ◽

Keijiro Yoritomi ◽

Miki Hiraiwa ◽

Yuetsu Tanaka ◽

...

Keyword(s):

T Cells ◽

T Cell ◽

Virus Type ◽

Binding Protein ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Jurkat T Cells ◽

Human T Cell ◽

Responsive Element

Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

Download Full-text

Seizing of T Cells by Human T-Cell Leukemia⧸Lymphoma Virus Type 1

Advances in Cancer Research ◽

10.1016/s0065-230x(03)01003-0 ◽

2003 ◽

pp. 69-132 ◽

Cited By ~ 48

Author(s):

Genoveffa Franchini ◽

Christophe Nicot ◽

Julie M Johnson

Keyword(s):

T Cells ◽

T Cell ◽

Virus Type ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Human T Cell

Download Full-text

Human T-Cell Leukemia Virus Type 1 Envelope Protein: Post-Entry Roles in Viral Pathogenesis

Viruses ◽

10.3390/v14010138 ◽

2022 ◽

Vol 14 (1) ◽

pp. 138

Author(s):

Victoria Maksimova ◽

Amanda R. Panfil

Keyword(s):

T Cells ◽

T Cell ◽

Virus Type ◽

Leukemia Virus ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Cell Leukemia Virus Type ◽

Human T Cell ◽

T Cell Leukemia Virus

Human T-cell leukemia virus type 1 (HTLV-1) is an oncogenic retrovirus that is the causative infectious agent of adult T-cell leukemia/lymphoma (ATL), an aggressive and fatal CD4+ T-cell malignancy, and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), a chronic neurological disease. Disease progression in infected individuals is the result of HTLV-1-driven clonal expansion of CD4+ T-cells and is generally associated with the activities of the viral oncoproteins Tax and Hbz. A closely related virus, HTLV-2, exhibits similar genomic features and the capacity to transform T-cells, but is non-pathogenic. In vitro, HTLV-1 primarily immortalizes or transforms CD4+ T-cells, while HTLV-2 displays a transformation tropism for CD8+ T-cells. This distinct tropism is recapitulated in infected people. Through comparative studies, the genetic determinant for this divergent tropism of HTLV-1/2 has been mapped to the viral envelope (Env). In this review, we explore the emerging roles for Env beyond initial viral entry and examine current perspectives on its contributions to HTLV-1-mediated disease development.

Download Full-text

Proviral Features of Human T Cell Leukemia Virus Type 1 in Carriers with Indeterminate Western Blot Analysis Results

Journal of Clinical Microbiology ◽

10.1128/jcm.00659-17 ◽

2017 ◽

Vol 55 (9) ◽

pp. 2838-2849 ◽

Cited By ~ 12

Author(s):

Madoka Kuramitsu ◽

Tsuyoshi Sekizuka ◽

Tadanori Yamochi ◽

Sanaz Firouzi ◽

Tomoo Sato ◽

...

Keyword(s):

T Cell ◽

Virus Type ◽

Proviral Load ◽

Leukemia Virus ◽

T Cell Leukemia ◽

Cell Leukemia ◽

Cell Leukemia Virus Type ◽

Human T Cell ◽

T Cell Leukemia Virus

ABSTRACTWestern blotting (WB) for human T cell leukemia virus type 1 (HTLV-1) is performed to confirm anti-HTLV-1 antibodies detected at the initial screening of blood donors and in pregnant women. However, the frequent occurrence of indeterminate results is a problem with this test. We therefore assessed the cause of indeterminate WB results by analyzing HTLV-1 provirus genomic sequences. A quantitative PCR assay measuring HTLV-1 provirus in WB-indeterminate samples revealed that the median proviral load was approximately 100-fold lower than that of WB-positive samples (0.01 versus 0.71 copy/100 cells). Phylogenic analysis of the complete HTLV-1 genomes of WB-indeterminate samples did not identify any specific phylogenetic groups. When we analyzed the nucleotide changes in 19 HTLV-1 isolates from WB-indeterminate samples, we identified 135 single nucleotide substitutions, composed of four types, G to A (29%), C to T (19%), T to C (19%), and A to G (16%). In the most frequent G-to-A substitution, 64% occurred at GG dinucleotides, indicating that APOBEC3G is responsible for mutagenesis in WB-indeterminate samples. Moreover, interestingly, five WB-indeterminate isolates had nonsense mutations in Pol and/or Tax, Env, p12, and p30. These findings suggest that WB-indeterminate carriers have low production of viral antigens because of a combination of a low proviral load and mutations in the provirus, which may interfere with host recognition of HTLV-1 antigens.

Download Full-text