Properties of sequence-tagged-site primer sets influencing repeatability

Genome ◽  
2000 ◽  
Vol 43 (1) ◽  
pp. 47-52 ◽  
Author(s):  
A Vanichanon ◽  
N K Blake ◽  
J M Martin ◽  
L E Talbert
Keyword(s):  
Genomic Dna ◽  
Standard Procedure ◽  
Gc Content ◽  
Pcr Primers ◽  
Gene Identification ◽  
Sequence Information ◽  
Chain Reaction ◽  
Sequence Tagged Site ◽  
Polymerase Chain ◽  
Primer Sets

The polymerase chain reaction (PCR) has become a standard procedure in plant genetics, and is the basis for many emerging genomics approaches to mapping and gene identification. One advantage of PCR is that sequence information for primer sets can be exchanged between laboratories, obviating the need for exchange and maintenance of biological materials. Repeatability of primer sets, whereby the same products are amplified in different laboratories using the same primer set, is important to successful exchange and utilization. We have developed several hundred sequence-tagged site (STS) primer sets for wheat and barley. The ability of the primer sets to generate reproducible amplifications in other laboratories has been variable. We wished to empirically determine the properties of the primer sets that most influenced repeatability. A total of 96 primer sets were tested with four genomic DNA samples on each of four thermocyclers. All major bands were repeatable across all four thermocyclers for approximately 50% of the primer sets. Characteristics most often associated with differences in repeatability included primer GC content and 3'-end stability of the primers. The propensity for primer-dimer formation was not a factor in repeatability. Our results provide empirical direction for the development of repeatable primer sets. Key words: STS-PCR primers, wheat, barley.

Transfer of sequence tagged site PCR markers between wheat and barley

Genome ◽  
1996 ◽  
Vol 39 (4) ◽  
pp. 802-810 ◽  
Author(s):  
J. E. Erpelding ◽  
N. K. Blake ◽  
T. K. Blake ◽  
L. E. Talbert
Keyword(s):  
Fragment Length Polymorphism ◽  
Pcr Markers ◽  
Chain Reaction ◽  
Chromosome Group ◽  
Sequence Tagged Site ◽  
Sequence Tagged Sites ◽  
Probability Of Success ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Mapping Information

Transfer of mapping information between related species has facilitated the development of restriction fragment length polymorphism (RFLP) maps in the cereals. Sequence tagged site (STS) primer sets for use in the polymerase chain reaction may be developed from mapped RFLP clones. For this study, we mapped 97 STS primer sets to chromosomes in wheat and barley to determine the potential transferability of the primer sets and the degree of correspondence between RFLP and STS locations. STS products mapped to the same chromosome group in wheat and barley 75% of the time. RFLP location predicted STS location 69% of the time in wheat and 56% of the time in barley. Southern hybridizations showed that most primer sets amplified sequences homologous to the RFLP clone, although additional sequences were often amplified that did not hybridize to the RFLP clone. Nontarget sequences were often amplified when primer sets were transferred across species. In general, results suggest a good probability of success in transferring STSs between wheat and barley, and that RFLP location can be used to predict STS location. However, transferability of STSs cannot be assumed, suggesting a need for recombinational mapping of STS markers in each species as new primer sets are developed. Key words : sequence tagged sites, PCR, wheat, barley.

Identification of barley genome segments introgressed into wheat using PCR markers

Genome ◽  
2001 ◽  
Vol 44 (1) ◽  
pp. 38-44 ◽  
Author(s):  
J D Sherman ◽  
L Y Smith ◽  
T K Blake ◽  
L E Talbert
Keyword(s):  
Seed Set ◽  
Barley Chromosome ◽  
Progeny Testing ◽  
Pcr Markers ◽  
Chain Reaction ◽  
Sequence Tagged Site ◽  
Chinese Spring Wheat ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Disomic Addition Lines

Barley has several important traits that might be used in the genetic improvement of wheat. For this report, we have produced wheat-barley recombinants involving barley chromosomes 4 (4H) and 7 (5H). Wheat-barley disomic addition lines were crossed with 'Chinese Spring' wheat carrying the ph1b mutation to promote homoeologous pairing. Selection was performed using polymerase chain reaction (PCR) markers to identify lines with the barley chromosome in the ph1b background. These lines were self pollinated, and recombinants were identified using sequence-tagged-site (STS) primer sets that allowed differentiation between barley and wheat chromosomes. Several recombinant lines were isolated that involved different STS-PCR markers. Recombination was confirmed by allowing the lines to self pollinate and rescreening the progeny via STS-PCR. Progeny testing confirmed 9 recombinants involving barley chromosome 4 (4H) and 11 recombinants involving barley chromosome 7 (5H). Some recombinants were observed cytologically to eliminate the possibility of broken chromosomes. Since transmission of the recombinant chromosomes was lower than expected and since seed set was reduced in recombinant lines, the utility of producing recombinants with this method is uncertain.Key words: introgression, sequence-tagged-site, recombination.

scholarly journals A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Plant Disease ◽  
1998 ◽  
Vol 82 (3) ◽  
pp. 285-290 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
K. E. Damann ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Its Region ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Ratoon Stunting Disease ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Sugarcane Ratoon

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Analysis of glutathione S-transferase genes polymorphisms and the risk of schizophrenia in a sample of Iranian population

2011 ◽  
Vol 7 (2-4) ◽  
pp. 199-203 ◽  
Author(s):  
Farah Lotfi Kashani ◽  
Dor Mohammad Kordi-Tamandani ◽  
Roya Sahranavard ◽  
Mohammad Hashemi ◽  
Farzaneh Kordi-Tamandani ◽  
...  
Keyword(s):  
Genomic Dna ◽  
Case Control Study ◽  
Gene Interaction ◽  
Case Control ◽  
Glutathione S Transferase ◽  
Chain Reaction ◽  
Healthy Control ◽  
Glutathione S Transferases ◽  
Polymerase Chain ◽  
Control Study

Glutathione S-transferases (GSTs) are major intracellular antioxidants, which, impaired in their function, are involved in the progress of schizophrenia (SCZ). The aim of this case-control study was to investigate the association between the polymorphism of glutathione S-transferases M1 (GSTM1), T1 (GSTT1), the glutathione S-transferase P1 gene (GSTP1) and SCZ. We isolated genomic DNA from peripheral blood of 93 individuals with SCZ and 99 healthy control subjects' genotypes analyzing them for GSTM1, GSTT1 and GSTP1 using polymerase chain reaction. The analysis of the gene–gene interaction between GSTs indicated that the magnitude of the association was greater for the combined AG/GSTT1 & GSTM1 genotypes (OR = 2.51; 95% CI: 1.13–5.63, P = 0.02). The AG and combined AG + GG genotypes of GSTP1 increased the risk of SCZ (OR = 1.83; 95% CI: 0.94–3.75 and OR = 1.71; 95% CI: 0.92–3.19, respectively). The genotypes of GSTT/NULL, NULL/GSTM and NULL/NULL increased the risk of SCZ (OR = 2.05; 95% CI: 0.9–4.74; OR = 2.0; 95% CI: 1.68–2.31; and OR = 1.8; 95% CI: 0.57–2.46, respectively). The present study supports previous data that suggest that impairment in the function of GSTs genes may increase the risk of SCZ.

Detection ofErwinia amylovorain plant material using novel polymerase chain reaction (PCR) primers

2001 ◽  
Vol 29 (1) ◽  
pp. 35-43 ◽  
Author(s):  
R. K. Taylor ◽  
P. J. Guilford ◽  
R. G. Clark ◽  
C. N. Hale ◽  
R. L. S. Forster
Keyword(s):  
Polymerase Chain Reaction ◽  
Plant Material ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Polymerase Chain

scholarly journals Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

2012 ◽  
Vol 32 (1) ◽  
pp. 201-208 ◽  
Author(s):  
Carla Bertechini Faria ◽  
Giovana Caputo Almeida-Ferreira ◽  
Karina Bertechine Gagliardi ◽  
Tatiane Cristina Albuquerque Alves ◽  
Dauri José Tessmann ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Fusarium Graminearum ◽  
Genomic Dna ◽  
Solid Medium ◽  
Food Contamination ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Culture Characteristics ◽  
Mycotoxigenic Fungi ◽  
Polymerase Chain

The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR) has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

Sign in / Sign up

Export Citation Format

Share Document