scholarly journals Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

2012 ◽  
Vol 32 (1) ◽  
pp. 201-208 ◽  
Author(s):  
Carla Bertechini Faria ◽  
Giovana Caputo Almeida-Ferreira ◽  
Karina Bertechine Gagliardi ◽  
Tatiane Cristina Albuquerque Alves ◽  
Dauri José Tessmann ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Fusarium Graminearum ◽  
Genomic Dna ◽  
Solid Medium ◽  
Food Contamination ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Culture Characteristics ◽  
Mycotoxigenic Fungi ◽  
Polymerase Chain

The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR) has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

scholarly journals A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Plant Disease ◽  
1998 ◽  
Vol 82 (3) ◽  
pp. 285-290 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
K. E. Damann ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Its Region ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Ratoon Stunting Disease ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Sugarcane Ratoon

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

scholarly journals Multiplex Polymerase Chain Reaction Method for Detection of Bovine Materials in Foodstuffs

2003 ◽  
Vol 86 (4) ◽  
pp. 764-767 ◽  
Author(s):  
Hong-Wei Gao ◽  
Da-Bing Zhang ◽  
Ai-Hu Pan ◽  
Wan-Qi Liang ◽  
Cheng-Zhu Liang
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Polymerase Chain Reaction Method ◽  
Rapid Identification ◽  
Ribosomal Gene ◽  
Effective Control ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Pcr Product ◽  
Polymerase Chain

Abstract Rapid identification of bovine materials in animal foodstuffs is essential for effective control of a potential source of bovine spongiform encephalophathy. A convenient polymerase chain reaction (PCR)-based assay was developed for detection and identification of a bovine-specific genomic DNA sequence in foodstuffs. Simultaneously the assay assessed the DNA quality of the experiment system by amplification of a highly conserved eucaryotic DNA region of the 18-S ribosomal gene, helping to check the reliability of the test result. The amplified bovine-specific PCR product was a genomic DNA fragment of lactoferrin, a low copy gene that was different from a commonly used bovine-specific mitochondria sequence for identification of bovine materials. The specificity of this method was confirmed by the absence of detectable homologous PCR product using reference foodstuff samples that lacked bovine-derived meat and bonemeals, or genomic DNA samples from vertebrates whose offals are commonly included in animal feeds. This method could detect the presence of bovine material in foodstuffs when the samples contained >0.02% bovine-derived meat and bone meal. Furthermore, it was not affected by prolonged heat treatment. The specificity, convenience, and sensitivity of this method suggest that it can be used for the routine detection of bovine-derived materials.

Human papillomavirus typing with GP5+/6+ polymerase chain reaction reverse line blotting and with commercial type-specific PCR kits

2006 ◽  
Vol 36 (2) ◽  
pp. 126-132 ◽  
Author(s):  
Anna Gillio-Tos ◽  
Laura De Marco ◽  
Valeria Ghisetti ◽  
Peter J.F. Snijders ◽  
Nereo Segnan ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Human Papillomavirus ◽  
Chain Reaction ◽  
Reverse Line Blotting ◽  
Specific Pcr ◽  
Polymerase Chain

scholarly journals Deteksi Transgen (Glu-1Dx5) pada Populasi Padi (Oryza sativa L.) Putative Transgenik Kultivar Fatmawati

Agrikultura ◽  
2010 ◽  
Vol 21 (1) ◽  
Author(s):  
Nono Carsono ◽  
Sri Nurlianti ◽  
Inez Nur Indrayani ◽  
Ade Ismail ◽  
Tri Joko Santoso ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Oryza Sativa ◽  
Dna Polymerase ◽  
Genomic Dna ◽  
Oryza Sativa L ◽  
Dna Purification ◽  
Coding Region ◽  
Chain Reaction ◽  
Taq Dna Polymerase ◽  
Polymerase Chain

Transformasi gen Glu-1Dx5, pengendali utama karakter elastisitas dan daya mengembang adonan dari gandum, telah berhasil ditransfer ke dalam genom tanaman padi kultivar Fatmawati dengan menggunakan penembakan partikel, dengan tujuan untuk memperbaiki kualitas adonan tepung beras. Galur-galur harapan telah diperoleh, tetapi karena telah mengalami penyerbukan sendiri selama 1-2 generasi yang menyebabkan transgen mengalami segregasi, maka diperlukan upaya pendeteksian transgen pada populasi putative transgenik ini. Upaya ini dapat dilakukan, antara lain dengan menggunakan teknik Polymerase Chain Reaction (PCR) yang memungkinkan perbanyakan fragmen DNA yang spesifik (gen) secara cepat dalam jumlah banyak.  Percobaan ini bertujuan untuk mendapatkan tanaman padi transgenik yang memiliki gen Glu-1Dx5 pada dua generasi yang sedang bersegregasi. DNA genom dari 149 tanaman padi (generasi T1 sebanyak 14 tanaman, generasi T2 sebanyak 134 tanaman, dan satu tanaman non-transgenik) telah diekstraksi menggunakan Genomic DNA Purification Kit dari Fermentas. Plasmid pK+Dx5 digunakan sebagai positif kontrol, selain itu digunakan juga enzim Taq DNA polymerase dari Go Green Taq® Master Mix (Promega) dan 2 primer spesifik yang mengamplifikasi coding region dari Glu-1Dx5 (2,5 kb). Hasil percobaan menunjukkan, tanaman padi yang memiliki gen Glu-1Dx5 pada generasi T2-7 sebanyak 26 tanaman, T2-11 : 12 tanaman, T2-12 : 3 tanaman, T2-40 : 3 tanaman dan T2-45 : 5 tanaman. Seluruh tanaman generasi T1 tidak memiliki insert. Hasil ini menunjukkan bahwa gen Glu-1Dx5 sudah terintegrasi ke dalam genom tanaman padi kultivar Fatmawati dan diwariskan dari satu generasi ke generasi berikutnya.

Sign in / Sign up

Export Citation Format

Share Document