scholarly journals Tomato Yellow Leaf Curl Virus Infection in a Monocotyledonous Weed (Eleusine indica)

2021 ◽  
Vol 37 (6) ◽  
pp. 641-651
Author(s):  
Eui-Joon Kil ◽  
Hee-Seong Byun ◽  
Hyunsik Hwang ◽  
Kyeong-Yeoll Lee ◽  
Hong-Soo Choi ◽  
...  
Keyword(s):  
Infectious Clone ◽  
Plant Viruses ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Eleusine Indica ◽  
The Family ◽  
Weed Hosts ◽  
Dicotyledonous Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is one of the most important plant viruses belonging to the genus Begomovirus of the family Geminiviridae. To identify natural weed hosts that could act as reservoirs of TYLCV, 100 samples were collected at a TYLCV-affected tomato farm in Iksan from 2013 to 2014. The sample weeds were identified as belonging to 40 species from 18 families. TYLCV was detected in 57 samples belonging to 28 species through polymerase chain reaction using root samples including five species (Eleusine indica, Digitaria ciliaris, Echinochloa crus-galli, Panicum dichotomiflorum, and Setaria faberi) from the family Poaceae. Whitefly Bemisia tabaci-mediated TYLCV transmission from TYLCV-infected E. indica plants to healthy tomatoes was confirmed, and inoculated tomatoes showed typical symptoms, such as leaf curling and yellowing. In addition, TYLCV was detected in leaf and root samples of E. indica plants inoculated by both whitefly-mediated transmission using TYLCV-viruliferous whitefly and agro-inoculation using a TYLCV infectious clone. The majority of mastreviruses infect monocotyledonous plants, but there have also been reports of mastreviruses that can infect dicotyledonous plants, such as the chickpea chlorotic dwarf virus. No exception was reported among begomoviruses known as infecting dicots only. This is the first report of TYLCV as a member of the genus Begomovirus infecting monocotyledonous plants.

scholarly journals Identification of Tomato yellow leaf curl virus-Is in The Bahamas

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 592-592 ◽  
Author(s):  
X. Sinisterra ◽  
C. P. Patte ◽  
S. Siewnath ◽  
J. E. Polston
Keyword(s):  
Dominican Republic ◽  
Infectious Clone ◽  
Monopartite Begomoviruses ◽  
Tomato Yellow Leaf ◽  
Common Source ◽  
Yellow Leaf ◽  
The Bahamas ◽  
Wide Range ◽  
Leaf Curl Virus ◽  
Leaf Curl

In December 1996, symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in number of fruits were first seen in tomato (Lycopersicon esculentum) plants on the island of North Andros, The Bahamas. Similar symptoms were observed for the first time during fall 1997 in tomatoes on the island of Eleuthera. Incidences of symptomatic plants were as high as 100% in some fields. Leaves from one symptomatic plant from each island were collected during April 1998. DNA was extracted from the samples and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses (2). Three sets of primers were used to amplify the extracts: PAL1c496 and PAL1v1978, which amplify an ≈1,100- or ≈1,300-bp DNA product from the A component of a wide range of bipartite and monopartite begomoviruses, respectively; primers PCRc154 and PBL1v2042, which amplify an ≈600-bp DNA fragment from the B component of a wide range of bipartite geminiviruses; and primers PCRc154 and PTYC1v2180 (5′ACTACCATGGCCGC-GCAGCGGAATAC3′), which preferentially amplify Tomato yellow leaf curl virus (TYLCV-Is) (1,2). DNA products of ≈1,300 and ≈780 bp were amplified with PAR1c496 and PAL1v1978 and PCRc154 and PTYC1v2180, respectively, from one sample from each island. No product was obtained from primers PCRc154 and PBL1v2042. The symptoms and PCR results are consistent for the presence of TYLCV. PCR products generated by primers PAL1c496 and PAL1v1978 from each sample were cloned into a pGEM-T Easy Vector (Promega, Madison, WI), and one clone from each was sequenced with vector primers. The sequences of the two 1,300-nt Bahamian clones were identical. The Bahamian clones shared 98.9% sequence homology with equivalent sequences of a TYLCV-Is clone from Florida, 99.2 and 99.4% homology with two TYLCV-Is clones from the Dominican Republic (GenBank Accession no. AF024715, and a full-length infectious clone submitted to GenBank), 98.7% homology with a clone from Cuba (GenBank Accession no. AJ223505), and 98.0% homology with the type sequence from Israel (GenBank Accession no. X15656). A deletion (28 or 29 nt) in the intergenic region was shared by clones from The Bahamas and Florida but was not present in clones from Cuba (AJ223505), the Dominican Republic (AF024715), Egypt (GenBank Accession no. L12219), Israel (X15656), Jamaica (GenBank Accession no. U84146), Lebanon (GenBank Accession no. AF160875), Mexico (GenBank Accession no. AF168709), and Spain (GenBank Accession no. AJ223505). TYLCV-Is appeared in The Bahamas and Florida at almost the same time (1). Because clones from both locations share an unusual deletion, there may be a common source for both introductions. This is the first report of TYLCV-Is in The Bahamas. Reference: (1) J. E. Polston et al. Plant Dis. 83:984, 1999. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals A Rapid and Efficient Method for Construction of an Infectious Clone of Tomato yellow leaf curl virus

2014 ◽  
Vol 30 (3) ◽  
pp. 310-315 ◽  
Author(s):  
Bongjun Bang ◽  
Jongyun Lee ◽  
Sunyoung Kim ◽  
Jungwook Park ◽  
Thao Thi Nguyen ◽  
...  
Keyword(s):  
Efficient Method ◽  
Infectious Clone ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Inheritance of Tomato yellow leaf curl virus Resistance Derived from Solanum pimpinellifolium UPV16991

Plant Disease ◽  
2007 ◽  
Vol 91 (7) ◽  
pp. 879-885 ◽  
Author(s):  
Ana Pérez de Castro ◽  
María José Díez ◽  
Fernando Nuez
Keyword(s):  
Partial Resistance ◽  
Tomato Yellow Leaf ◽  
Incomplete Penetrance ◽  
Yellow Leaf ◽  
Solanum Pimpinellifolium ◽  
Breeding Lines ◽  
The Family ◽  
Group A ◽  
Leaf Curl Virus ◽  
Leaf Curl

Resistance to tomato yellow leaf curl disease (TYLCD) in accession UPV16991 Solanum pimpinellifolium has been previously reported by our group. A breeding program was developed from an initial S. lycopersicum × S. pimpinellifolium UPV16991 cross. This first cross was followed by several selfing generations. Selection for resistance to Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leaf curl Sardinia virus (TYLCSV) was carried out for plants of each generation. One partially resistant F6 plant (L102) was chosen to form the family to study the genetic control of resistance to TYLCV. Crosses between four breeding lines susceptible to TYLCD and L102 were also performed to study the dominance of the resistance in S. lycopersicum genetic backgrounds. Response to TYLCV infection of P1, P2, F1, F2, BC1, and BC2 generations fitted, for this line, a monogenic control with partial recessiveness and incomplete penetrance. The percentage of homozygotic plants with partial resistance was 72.75. Among the four hybrids developed, the highest levels of resistance were found in the hybrid formed from the most vigorous S. lycopersicum line. These results must be considered for breeding purposes. Partial resistance derived from UPV16991 will be useful in homozygosis or combined with resistance genes from other sources.

scholarly journals Resistance to Tomato yellow leaf curl virus Accumulation in the Tomato Wild Relative Solanum habrochaites Associated with the C4 Viral Protein

2011 ◽  
Vol 24 (7) ◽  
pp. 849-861 ◽  
Author(s):  
Diego M. Tomás ◽  
M. Carmen Cañizares ◽  
Jesús Abad ◽  
Rafael Fernández-Muñoz ◽  
Enrique Moriones
Keyword(s):  
Control Method ◽  
Infectious Clone ◽  
Systemic Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Sources Of Resistance ◽  
Virus Accumulation ◽  
Solanum Habrochaites ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl disease (TYLCD) is a severe threat to tomato crops worldwide and is caused by Tomato yellow leaf curl virus (TYLCV) and several other begomoviruses (genus Begomovirus, family Geminiviridae). Host plant resistance is the best TYLCD control method but limited sources of resistance are available. In this study, two Solanum habrochaites TYLCD-resistance sources, EELM-388 and EELM-889, were found after a wide germplasm screening and were further characterized. A consistent resistance to the widely distributed strain TYLCV-IL was observed when plants were inoculated by Bemisia tabaci or by agroinoculation using an infectious clone, with no symptoms or virus accumulation observed in inoculated plants. Moreover, the resistance was effective under field conditions with high TYLCD pressure. Two independent loci, one dominant and one recessive, were associated with EELM-889 resistance. The study shows these loci to be distinct from that of the resistance gene (Ty-1 gene) commonly deployed in commercial tomato cultivars. Therefore, both kinds of resistance could be combined to provide improved resistance to TYLCD. Four additional TYLCD-associated viruses were challenged, showing that the resistance always prevented symptom expression, although systemic infection could occur in some cases. By using chimeric and mutant expression constructs, the C4 protein was shown to be associated with the ability to result in effective systemic infection.

Three distinct groups of isolates of Tomato yellow leaf curl virus in Japan and construction of an infectious clone

2004 ◽  
Vol 70 (4) ◽  
Author(s):  
Shigenori Ueda ◽  
Takashi Kimura ◽  
Masatoshi Onuki ◽  
Kaoru Hanada ◽  
Toru Iwanami
Keyword(s):  
Infectious Clone ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Molecular Characterization of Tomato Yellow Leaf Curl Virus in Korea and the Construction of an Infectious Clone

2014 ◽  
Vol 20 (3) ◽  
pp. 219-222
Author(s):  
Bong Choon Lee ◽  
Shigenori Ueda ◽  
Young-Nam Yoon ◽  
Dong Bum Shin ◽  
Hang-Won Kang
Keyword(s):  
Molecular Characterization ◽  
Infectious Clone ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Tomato yellow leaf curl virus in Acalypha australis in China

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 430-430 ◽  
Author(s):  
Y. H. Ji ◽  
H. Zhang ◽  
K. Zhang ◽  
G. Li ◽  
S. Lian ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Jiangsu Province ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Circular Dna ◽  
First Report ◽  
Weed Hosts ◽  
Total Dna ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.

Sign in / Sign up

Export Citation Format

Share Document