scholarly journals First report of gray mold rot disease on tomato (Solanum lycopersicum L.) caused by Botrytis cinerea in Malaysia

2018 ◽  
Vol 101 (1) ◽  
pp. 207-207 ◽  
Author(s):  
Ahmadu Tijjani ◽  
Siti Izera Ismail ◽  
Ahmad Khairulmazmi ◽  
Omar Dzolkhifli
Keyword(s):  
Botrytis Cinerea ◽  
Solanum Lycopersicum ◽  
Gray Mold ◽  
First Report ◽  
Solanum Lycopersicum L ◽  
Rot Disease ◽  
Gray Mold Rot

scholarly journals First Report of Postharvest Gray Mold Rot on Carrot Caused by Botrytis cinerea in Korea

2014 ◽  
Vol 20 (2) ◽  
pp. 129-131 ◽  
Author(s):  
Md. Aktaruzzaman ◽  
Joon-Young Kim ◽  
Sheng-Jun Xu ◽  
Byung-Sup Kim
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
First Report ◽  
Gray Mold Rot

First report of root rot disease on Solanum lycopersicum L. caused by Fusarium vanettenii in India

2021 ◽  
Author(s):  
Rubin Debbarma ◽  
Deeba Kamil ◽  
Bishnu Maya Bashyal ◽  
Shiv Pratap Choudhary ◽  
Prameeladevi Thokla
Keyword(s):  
Solanum Lycopersicum ◽  
Root Rot ◽  
First Report ◽  
Root Rot Disease ◽  
Solanum Lycopersicum L ◽  
Rot Disease

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold Disease on Peach from Pakistan

2018 ◽  
Vol 7 (3) ◽  
pp. 131-131
Author(s):  
Raees Ahmed ◽  
Amjad S. Gondal ◽  
Muhammad Tariq Khan ◽  
Shazia Shahzaman ◽  
Sajjad Hyder
Keyword(s):  
Botrytis Cinerea ◽  
Mycelial Growth ◽  
Agar Medium ◽  
Management Strategies ◽  
Gray Mold ◽  
First Report ◽  
Average Production ◽  
Conducive Environment ◽  
Hyphal Tip ◽  
Important Disease

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan. 

scholarly journals First Report of Fenhexamid-Resistant Botrytis cinerea Causing Gray Mold on Heurchera in a North American Greenhouse

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 147-147 ◽  
Author(s):  
G. W. Moorman ◽  
A.-S. Walker ◽  
S. May
Keyword(s):  
Botrytis Cinerea ◽  
Mode Of Action ◽  
Gray Mold ◽  
North Central ◽  
First Report ◽  
Group I ◽  
Central Pennsylvania ◽  
Commercial Operation ◽  
Penn State ◽  
Botryotinia Fuckeliana

Greenhouse-grown Heuchera plants, treated with fenhexamid (Decree, SePRO, Carmel, IN; FRAC group 17 hydroxyanilide), with active gray mold were submitted to the Penn State Plant Disease Clinic in December 2010 from a commercial operation in north-central Pennsylvania. Genetic and phenotypic analyses identified the isolate as Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel), HydR3 phenotype (2) and not B. pseudocinerea (previously Botrytis group I) (4), naturally resistant to fenhexamid (phenotype HydR1) (1). While 0.2 μg of fenhexamid per ml or less is required to slow mycelial growth and germ tube elongation of sensitive isolates by 50% (EC50), the radial growth EC50 of the Heuchera isolate was approximately 2,000 μg of fenhexamid per ml in culture. Five cucumber seedlings receiving 25 μl of 0.1 M dextrose containing the label rate of Decree (1,800 μg/ml) on the growing tip were inoculated with colonized agar in the drop. Five check plants received 25 μl of 0.1 M dextrose. B. cinerea from silica gel storage since 1988 was also tested. This experiment was repeated three times. The 1988 isolate killed all fungicide-free but no fenhexamid-treated plants. The Heuchera isolate killed all fungicide-free and fenhexamid-treated plants within 4 days. To our knowledge, this is the first report of B. cinerea from a greenhouse in North America with fenhexamid resistance. Resistance occurs in U.S. fields (3). The Heuchera isolate's HydR3 resistance phenotype (2) has been detected in Germany, Japan, and France and has mutations affecting the 3-keto reductase protein, encoded by the erg27 gene, the specific target of fenhexamid and involved in Botrytis sterol biosynthesis. The Decree label states that it is to be used only twice on a crop before switching to a different mode of action. Greenhouses have resident Botrytis populations that are likely to be exposed to any fungicide applied in the structure. Growers should consider using fenhexamid only twice in a particular greenhouse, rather than on a particular crop, before switching to a different mode of action. References: (1) P. Leroux et al. Crop Prot. 18:687, 1999.(2) P. Leroux et al. Pest Manag. Sci. 58:876, 2002. (3) Z. Ma and T. J. Michailides. Plant Dis. 89:1083, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

scholarly journals First Report of Gray Mold on Allium victorialis var. platyphyllum Caused by Botrytis cinerea in Korea

Plant Disease ◽  
2017 ◽  
Vol 101 (1) ◽  
pp. 256-256
Author(s):  
M. Aktaruzzaman ◽  
Y. G. Lee ◽  
T. Afroz ◽  
B. S. Kim ◽  
H. D. Shin
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
First Report

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

scholarly journals First Report of Gray Mold Disease of Sponge Gourd (Luffa cylindrica) Caused by Botrytis cinerea in Korea

2016 ◽  
Vol 22 (2) ◽  
pp. 107-110
Author(s):  
Md. Aktaruzzaman ◽  
Tania Afroz ◽  
Byung-Sup Kim ◽  
Hyeon-Dong Shin
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Luffa Cylindrica ◽  
First Report ◽  
Sponge Gourd

scholarly journals First Report of Fludioxonil Resistance in Botrytis cinerea, the Causal Agent of Gray Mold, From Strawberry Fields in Spain

Plant Disease ◽  
2016 ◽  
Vol 100 (8) ◽  
pp. 1779-1779
Author(s):  
D. Fernández-Ortuño ◽  
J. A. Torés ◽  
A. Pérez-García ◽  
A. de Vicente
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Causal Agent ◽  
First Report
Sign in / Sign up

Export Citation Format

Share Document