First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽

10.1094/pd-89-0528b ◽

2005 ◽

Vol 89 (5) ◽

pp. 528-528 ◽

Cited By ~ 1

Author(s):

R. J. Holguín-Peña ◽

F. G. Arcos

Keyword(s):

Botrytis Cinerea ◽

Baja California ◽

Polymerase Chain Reaction Amplification ◽

Random Amplified Polymorphic Dna ◽

Gray Mold ◽

Malt Extract ◽

Conidial Suspension ◽

Sterile Water ◽

Tomato Production ◽

First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

Download Full-text

First Report of Paraphoma chrysanthemicola Causing Crown and Leaf Rot of Atractylodes lancea in China

Plant Disease ◽

10.1094/pdis-11-21-2408-pdn ◽

2022 ◽

Author(s):

Hongyang Wang ◽

Chuanzhi Kang ◽

Wang Yue-Feng ◽

Sheng Wang ◽

Zhang Yan ◽

...

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Crown Rot ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

First Report ◽

Atractylodes Lancea ◽

Detached Leaves ◽

Leaf Rot

Atractylodes lancea is an important traditional Chinese medicinal plant whose rhizome is used for treating complaints such as rheumatic diseases, digestive disorders, night blindness and influenza. Jiangsu Province is the optimal cultivation location for high-quality A. lancea rhizome. Since June 2019, symptoms of crown rot and leaf rot were observed in about 10-20% of the A. lancea in a plantation (31° 36' 1" N, 119° 6' 40" W) in Lishui, Jiangsu, China. Lesions occurred on the stem near the soil line and on the leaves (Fig. 1A). Disease incidence reached approximately 80-90% by September, 2021 (Fig. 1B) and resulted in severe loss of rhizome and seed yields. For pathogen isolation, ten samples of symptomatic stem segments and ten diseased leaves were collected, surface-sterilized using 5% NaClO solution, rinsed with sterile water, cut into 0.5-2 cm segments, and plated to potato dextrose agar (PDA), and then incubated at 30°C in darkness. Pure cultures of four isolates showing morphological characteristics of Paraphoma spp. were obtained, identified as a single P. chrysanthemicola strain, and named LSL3f2. Newly formed colonies initially consisted of white mycelia; the five-day-old colonies developed a layer of whitish grey mycelia with a grey underside. 20-day-old colonies had white mycelium along the margin and with a faint yellow inner circular part with irregular radial furrows, and the reverse side looking caramel and russet (Fig. 1C). Pycnidia were subglobose (diameter: 5 to 15 μm; Fig. 1D). Unicellular, bicellular or strings of globose or subglobose chlamydospores developed from hyphal cells (Fig. 1E and 1F). The internal transcribed spacer (ITS) region and large subulin-28S of LSL3f2 were cloned using primers ITS1/ITS4 and LR0R/LR7 (Aveskamp et al. 2010, Li et al. 2013), and deposited in GenBank (OK559658 and OK598973, respectively). BLASTn search and phylogenetic analysis showed the highest identity between LSL3f2 and P. chrysanthemicola sequences (Fig. 1G) and confirmed LSL3f2 as P. chrysanthemicola. Koch’s postulates were completed using one-month-old vegetatively propagated A. lancea plantlets growing on autoclaved vermiculite/peat mixture at 26°C with a light/dark cycle of 12/12 hours. Each plantlet was inoculated with 5 ml of conidial suspension in water (1 × 108 cfu/ml) by applying to soil close to the plantlet, with sterile water used as a mock control (n = 10). By 20 days post-inoculation, inoculated plantlets showed a range of disease symptoms consistent to those observed in infested fields (Fig. 1H). Pathogenicity was additionally confirmed using detached leaves inoculated with a colonized agar plug of LSL3f2 or an uninoculated control comparison (diameter = 5 mm) and incubated at 26℃ in the dark. Five to seven days post-inoculation, detached leaves showed leaf rot symptoms including lesions, yellowing and withering consistent with those in infested fields, while control leaves remained healthy (n = 10, Fig. 1I). The pathogen was reisolated from the diseased plantlets and detached leaves, in both cases demonstrating the micromorphological characteristics of LSL3f2. P. chrysanthemicola has been reported to cause leaf and crown rot on other plants such as Tanacetum cinerariifolium (Moslemi et al. 2018), and leaf spot on A. japonicain (Ge et al. 2016). However, this is the first report of P. chrysanthemicola causing crown and leaf rot on A. lancea in China.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽

10.1094/pdis-06-20-1373-pdn ◽

2020 ◽

Author(s):

Boda Praveen ◽

A. Nagaraja ◽

M. K. Prasanna Kumar ◽

Devanna Pramesh ◽

K. B. Palanna ◽

...

Keyword(s):

Crop Yields ◽

Disease Incidence ◽

Leaf Blight ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Pcr Assay ◽

Causal Organism ◽

First Report ◽

Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

Download Full-text

First Report of Leaf Spot Disease Caused by Epicoccum nigrum on Lablab purpureus in India

Plant Disease ◽

10.1094/pdis-07-13-0798-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 284-284 ◽

Cited By ~ 12

Author(s):

S. Mahadevakumar ◽

K. M. Jayaramaiah ◽

G. R. Janardhana

Keyword(s):

Leaf Spot ◽

Leaf Surface ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Post Inoculation ◽

Conidial Suspension ◽

Lablab Purpureus ◽

First Report ◽

Spot Disease ◽

Epicoccum Nigrum

Lablab purpureus (L.) Sweet (Indian bean) is an important pulse crop grown in arid and semi-arid regions of India. It is one of the most widely cultivated legume species and has multiple uses. During a September 2010 survey, we recorded a new leaf spot disease on L. purpureus in and around Mysore district (Karnataka state) with 40 to 80% disease incidence in 130 ha of field crop studied, which accounted for 20 to 35% estimated yield loss. The symptoms appeared as small necrotic spots on the upper leaf surface. The leaf spots were persistent under mild infection throughout the season with production of conidia in clusters on abaxial leaf surface. A Dueteromyceteous fungus was isolated from affected leaf tissues that were surface sterilized with 2% NaOCl2 solution then washed thrice, dried, inoculated on potato dextrose agar (PDA) medium, and incubated at 28 ± 2°C at 12 h alternate light and dark period for 7 days. The fungal colony with aerial mycelia interspersed with dark cushion-shaped sporodochia consists of short, compact conidiophores bearing large isodiametric, solitary, muricate, brown, globular to pear shaped conidia (29.43 to 23.92 μm). Fungal isolate was identified as Epicoccum sp. based on micro-morphological and cultural features (1). Further authenticity of the fungus was confirmed by PCR amplification of the internal transcribed spacer (ITS) region using ITS1/ITS4 universal primer. The amplified PCR product was purified, sequenced directly, and BLASTn search revealed 100% homology to Epicoccum nigrum Link. (DQ093668.1 and JX914480.1). A representative sequence of E. nigrum was deposited in GenBank (Accession No. KC568289.1). The isolated fungus was further tested for its pathogenicity on 30-day-old healthy L. purpureus plants under greenhouse conditions. A conidial suspension (106 conidia/ml) was applied as foliar spray (three replicates of 15 plants each) along with suitable controls. The plants were kept under high humidity (80%) for 5 days and at ambient temperature (28 ± 2°C). The appearance of leaf spot symptoms were observed after 25 days post inoculation. Further, the pathogen was re-isolated and confirmed by micro-morphological characteristics. E. nigrum has been reported to cause post-harvest decay of cantaloupe in Oklahoma (2). It has also been reported as an endophyte (3). Occurrence as a pathogen on lablab bean has not been previously reported. To our knowledge, this is the first report of the occurrence of E. nigrum on L. purpureus in India causing leaf spot disease. References: (1) H. L. Barnet and B. B. Hunter. Page 150 in: Illustrated Genera of Imperfect Fungi, 1972. (2) B. D. Bruten et al. Plant Dis. 77:1060, 1993. (3) L. C. Fávaro et al. PLoS One 7(6):e36826, 2012.

Download Full-text

First Report of Botrytis pseudocinerea Causing Gray Mold on Tomato (Lycopersicon esculentum) in Central China

Plant Disease ◽

10.1094/pdis-03-14-0256-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 283-283 ◽

Cited By ~ 6

Author(s):

N. Li ◽

J. Zhang ◽

L. Yang ◽

M. D. Wu ◽

G. Q. Li

Keyword(s):

Tomato Fruit ◽

Low Frequency ◽

Gray Mold ◽

Central China ◽

Bootstrap Support ◽

Conidial Suspension ◽

Tomato Plants ◽

First Report ◽

Molecular Features ◽

Tomato Field

A tomato field in Qianjiang County, Hubei Province, China, was surveyed for gray mold in April 2013. Diseased leaves with V-shaped lesions along the margin and masses of grayish hyphae and conidia on the surface were collected from different plants. Eight Botrytis isolates were obtained from eight symptomatic leaves by plating the conidia from each leaf onto potato dextrose agar (PDA). A representative isolate (No. 116) was compared to two reference isolates, B. cinerea B05.10 (from Z. H. Ma, Zhejiang University, China) and B. pseudocinerea 10091 (from A. S. Walker, INRA, France) for morpho-cultural and molecular features. On PDA at 20°C, isolate 116 grew 13.8 mm/day (n = 9), which was similar to those of isolates 10091 (13.7 mm/day), and B05.10 (14.6 mm/day). The isolates all formed black sclerotia of similar shape and size (2 to 13 × 1 to 7 mm). To induce conidia production, the isolates each were inoculated onto tomato fruit (cv. Hezuo 903, Jiangsu Seed Co., China) using colonized agar plugs (each 6 mm in diameter), with four plugs per fruit and four fruits tested per isolate. After incubation of the fruit for 10 days (20°C), abundant conidia were produced on the fruit surface. The conidial size of isolate 116 (6.8 to 14.3 × 6.1 to 10.2 μm) was similar to that of isolates 10091 (7.7 to 12.2 × 7.0 to 9.8 μm) and B05.10 (7.0 to 14 × 6.6 to 10.5 μm). The three isolates were indistinguishable morphologically. The sequences of each of four nuclear genes (Bc-hch, G3PDH, HSP60, and MS547) and the microsatellite Bc6 locus (1,4) were determined and analyzed for each isolate. DNA was extracted from mycelium of each isolate and used as a template to amplify each gene by PCR using specific primers (1,2,4). Bc-hch-RFLP genotyping of the 1,171-bp amplicon (2,4) showed that isolates 116 and 10091 had a 601-bp DNA product, whereas B05.10 had a 517-bp product. The G3PDH, HSP60, and MS547 sequences of isolate 116 (GenBank Accession Nos. KJ534270, KJ534271, and KJ534273, respectively) and those of B. aclada, B. calthae, B. cinerea, B. pseudocinerea, and Sclerotinia sclerotiorum (3) were used for phylogenetic analysis. Isolate 116 and eight B. pseudocinerea isolates formed a subclade with 100% bootstrap support. Furthermore, two DNA markers, 86 bp for isolates 116 and 10091 vs. 170 bp for B05.10 were identified at the Bc6 locus. These results suggest that isolate 116 belongs to B. pseudocinerea (1,4). Pathogenicity of each isolate was tested by inoculation of each of five newly expanded tomato leaves on a 50-day-old plant (cv. Hezuo 903, Jiangsu Seed Co) with a 20-μl droplet of a conidial suspension (1 × 105 conidia/ml), using a pipette. Five noninoculated control leaves were treated similarly with water. The plants were all maintained at 20°C and 100% RH for 72 h, and lesion diameter was then measured. While control leaves remained asymptomatic, leaves inoculated with isolates 116, 10091, and B05.10 developed necrotic lesions averaging 19 to 20 mm in diameter. A fungus re-isolated from the lesions on isolate-116–inoculated leaves formed colonies with morphology identical to that of the original isolate 116. To our knowledge, this is the first report of B. pseudocinerea on tomato in China. The remaining seven isolates were identified as B. cinerea based on Bc-hch-RFLP genotyping (data not shown), suggesting that B. pseudocinerea may infect tomato plants at a low frequency in this region of China. References: (1) E. Fournier et al. Mol. Ecol. Notes 2:253, 2002. (2) E. Fournier et al. Mycologia 95:251, 2003. (3) P. R. Johnston et al. Plant Pathol. 63:888, 2014. (4) A. S. Walker et al. Phytopathology 101:1433, 2011.

Download Full-text

First Report on Ovate-leaf Atractylodes Damping-off Caused by Fusarium oxysporum species Complex in South Korea

Plant Disease ◽

10.1094/pdis-05-21-1107-pdn ◽

2021 ◽

Author(s):

Oliul Hassan ◽

Taehyun Chang

Keyword(s):

South Korea ◽

Fusarium Oxysporum ◽

Species Complex ◽

Disease Incidence ◽

Fusarium Species ◽

Morphological Characteristics ◽

Conidial Suspension ◽

Sterile Water ◽

Damping Off ◽

First Report

In South Korea, ovate-leaf atractylodes (OLA) (Atractylodes ovata) is cultivated for herbal medicine. During May to June 2019, a disease with damping off symptoms on OLA seedlings were observed at three farmer fields in Mungyeong, South Korea. Disease incidence was estimated as approximately 20% based on calculating the proportion of symptomatic seedlings in three randomly selected fields. Six randomly selected seedlings (two from each field) showing damping off symptoms were collected. Small pieces (1 cm2) were cut from infected roots, surface-sterilized (1 minute in 0.5% sodium hypochlorite), rinsed twice with sterile water, air-dried and then plated on potato dextrose agar (PDA, Difco, and Becton Dickinson). Hyphal tips were excised and transferred to fresh PDA. Six morphologically similar isolates were obtained from six samples. Seven-day-old colonies, incubated at 25 °C in the dark on PDA, were whitish with light purple mycelia on the upper side and white with light purple at the center on the reverse side. Macroconidia were 3–5 septate, curved, both ends were pointed, and were 19.8–36.62 × 3.3–4.7 µm (n= 30). Microconidia were cylindrical or ellipsoid and 5.5–11.6 × 2.5–3.8 µm (n=30). Chlamydospores were globose and 9.6 –16.3 × 9.4 – 15.0 µm (n=30). The morphological characteristics of present isolates were comparable with that of Fusarium species (Maryani et al. 2019). Genomic DNA was extracted from 4 days old cultures of each isolate of SRRM 4.2, SRRH3, and SRRH5, EF-1α and rpb2 region were amplified using EF792 + EF829, and RPB2-5f2 + RPB2-7cr primer sets, respectively (Carbone and Kohn, 1999; O'Donnell et al. 2010) and sequenced (GenBank accession number: LC569791- LC569793 and LC600806- LC600808). BLAST query against Fusarium loci sampled and multilocus sequence typing database revealed that 99–100% identity to corresponding sequences of the F. oxysporum species complex (strain NRRL 28395 and 26379). Maximum likelihood phylogenetic analysis with MEGA v. 6.0 using the concatenated sequencing data for EF-1α and rpb2 showed that the isolates belonged to F. oxysporum species complex. Each three healthy seedlings with similar sized (big flower sabju) were grown for 20 days in a plastic pot containing autoclaved peat soil was used for pathogenicity tests. Conidial suspensions (106 conidia mL−1) of 20 days old colonies per isolate (two isolates) were prepared in sterile water. Three pots per strain were inoculated either by pouring 50 ml of the conidial suspension or by the same quantity of sterile distilled water as control. After inoculation, all pots were incubated at 25 °C with a 16-hour light/8-hour dark cycle in a growth chamber. This experiment repeated twice. Inoculated seedlings were watered twice a week. Approximately 60% of the inoculated seedlings per strain wilted after 15 days of inoculation and control seedlings remained asymptomatic. Fusarium oxysporum was successfully isolated from infected seedling and identified based on morphology and EF-1α sequences data to confirm Koch’s postulates. Fusarium oxysporum is responsible for damping-off of many plant species, including larch, tomato, melon, bean, banana, cotton, chickpea, and Arabidopsis thaliana (Fourie et al. 2011; Hassan et al.2019). To the best of our knowledge, this is the first report on damping-off of ovate-leaf atractylodes caused by F. oxysporum in South Korea. This finding provides a basis for studying the epidemic and management of the disease.

Download Full-text

First report of Fusarium incarnatum causing spikelet rot on rice in China

Plant Disease ◽

10.1094/pdis-12-20-2660-pdn ◽

2021 ◽

Author(s):

Ling Wang ◽

S. L. Ge ◽

Kehan Zhao ◽

huang Shiwen

Keyword(s):

Natural Science ◽

Disease Incidence ◽

Science And Technology ◽

Agricultural Science ◽

Zhejiang Province ◽

Maturity Stage ◽

Post Inoculation ◽

Distilled Water ◽

Conidial Suspension ◽

First Report

Rice (Oryza sativa L.) is the most important and widely grown crop, covering about 29.9 million ha of total cultivation area in China. In the last decade, spikelet rot disease on rice became much more frequent in the middle and lower reaches of the Yangtze River, China. Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg was reported to be a causal agent of spikelet rot on rice in Hangzhou, Zhejiang province (Huang et al. 2012). In September 2019, a survey was conducted to understand the etiology of the disease in the main rice growing regions of Jinshan District of Shanghai. Symptomatic panicles exhibiting reddish or brown discoloration on the glumes were collected from different rice fields, where disease incidence was estimated to be between 20 to 80%. Diseased glumes were cut into small sections (5 × 5 mm) from the boundary of necrotic and healthy tissues, surface-sterilized with 75% ethanol for 30 s and 3% sodium hypochlorite for 90 s, rinsed twice with sterile distilled water, then placed onto 1/5 strength potato dextrose agar (PDA). After 3 to 5 days of incubation at 28°C in the dark, fungal growth with Fusarium-like colonies were transferred to PDA and purified by the single-spore isolation method. A total of 12 isolates were obtained and colonies showed loosely floccose, white mycelium and pale-yellow pigmentation on PDA. Microconidia were ovoid mostly with 0 to 1 septum, and measured 4.2 to 16.6 × 2.5 to 4.1 μm (n = 50). After 5-7 days of inoculation on carnation leaf agar (CLA), macroconidia produced usually had 3 to 5 septa, slightly curved at the apex, ranging from 15.7 to 39.1 × 3.3 to 5.0 μm (n = 50). Chlamydospores were produced in hyphae, most often solitary in short chains or in clumps, ellipsoidal or subglobose with thick and roughened walls. Molecular identification was performed on the representative isolates (JS3, JS9, and JS21). The rDNA internal transcribed spacer (ITS), translation elongation factor (TEF-1α) and β-tubulin (β-TUB) genes were amplified and sequenced using the paired primers ITS1/ITS4 (White et al. 1990), EF1/EF2 (O’Donnell et al. 1998) and T1/T22 (O’Donnell and Cigelnik 1997), respectively. The obtained sequences were deposited in GenBank under accession numbers MT889972 to MT889974 (ITS), MT895844 to MT895846 (TEF-1α), and MT895841 to MT895843 (β-TUB), respectively. BLASTn search of the sequences revealed 99 to 100% identity with ITS (MF356578), TEF-1α (HM770725) and β-TUB (GQ915444) of Fusarium incarnatum isolates. FUSARIUM-ID (Geiser et al. 2004) analysis showed 99 to 100% similarity with sequences of the F. incarnatum-equiseti species complex (FIESC) (FD_01651 and FD_01628). In addition, a phylogenetic analysis based on the concatenated nucleotide sequences placed the isolates in the F. incarnatum clade at 100% bootstrap support. Thus, both morphological observations and molecular criteria supported identification of the isolates as F. incarnatum (Desm.) Sacc (synonym: Fusarium semitectum) (Leslie and Summerell 2006, Nirenberg 1990). Pathogenicity tests were performed on susceptible rice cultivar ‘Xiushui134’. At pollen cell maturity stage, a 2-ml conidial suspension (5 × 105 macroconidia/ml) of each isolate was injected into 10 rice panicles. Control plants were inoculated with sterile distilled water. Then, the pots were kept in a growth chamber at 28°C, 80% relative humidity, and 12 h/12 h light (10,000 lux)/dark. The experiment was repeated two times for each isolate. Two weeks post-inoculation, all inoculated panicles showed similar symptoms with the original samples, whereas no symptoms were observed on the control. The pathogen was re-isolated from inoculated panicles and identified by the method described above to fulfill Koch's postulates. Previous studies reported that F. incarnatum reproduced perithecia to overwinter on rice stubble as the inoculum of Fusarium head blight of wheat in southern China (Yang et al. 2018). To our knowledge, this is the first report of spikelet rot on rice caused by F. incarnatum in China. Further investigation is needed to gain a better understanding its potential geographic distribution of this new pathogen on rice crop. References: (1) Huang, S. W., et al. 2011. Crop Prot. 30: 10. (2) White, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. (3) O’Donnell, K., et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95: 2044. (4) O'Donnell, K., Cigelnik, E. 1997. Mol. Phylogenet. Evol. 7: 103. (5) Geiser, D. M., et al. 2004. Eur. J. Plant Pathol. 110: 473. (6) Leslie, J. F., and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell, Ames, IA. (7) Nirenberg, H. I. 1990. Stud. Mycol. 32: 91. (8) Yang, M. X., et al. 2018. Toxins. 10: 115. The author(s) declare no conflict of interest. Funding: Funding was provided by National Natural Science Foundation of China (grant no. 31800133), Zhejiang Provincial Natural Science Foundation of China (grant no. LQ18C140005), Key Research and Development Program of Zhejiang Province (grant no. 2019C02018), Shanghai Science and Technology for Agriculture Promotion Project (2019-02-08-00-08-F01127), and the Agricultural Science and Technology Innovation Program of China Academy of Agricultural Science (CAAS-ASTIP-2013- CNRRI).

Download Full-text

First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽

10.1094/pd-89-0910c ◽

2005 ◽

Vol 89 (8) ◽

pp. 910-910 ◽

Cited By ~ 2

Author(s):

J. E. Woodward ◽

T. B. Brenneman ◽

R. C. Kemerait ◽

A. K. Culbreath ◽

J. R. Clark

Keyword(s):

Botrytis Cinerea ◽

Disease Incidence ◽

Block Design ◽

Gray Mold ◽

American Phytopathological Society ◽

Breeding Programs ◽

First Report ◽

Tomato Spotted Wilt ◽

Arachis Hypogaea L ◽

Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

Download Full-text

Pathogenic Capacity of Botrytis cinerea on Leaves of Pyrus mamorensis, an Endemic Tree of Mamora Forest in Morocco

Atlas Journal of Biology ◽

10.5147/ajb.v2i2.159 ◽

2017 ◽

Vol 2 (2) ◽

pp. 125-129

Author(s):

Zineb Sellal ◽

Jamila Dahmani ◽

Rachid Benkirane ◽

Amina Ouazzani Touhami ◽

Allal Douira

Keyword(s):

Botrytis Cinerea ◽

Disease Severity ◽

Filter Paper ◽

Pathogenic Fungus ◽

Gray Mold ◽

Conidial Suspension ◽

First Report ◽

Conidia Production

A survey in the Mamora forest was done in the spring of 2010 and revealed that 67% of buds and 27% of leaves of Pyrus mamorensis (Trabut) samples collected had lesions with a gray felting. The pathogenic fungus was identified as Botrytis cinerea by the filter – paper technic. Koch´s postulate was verified by inoculating healthy leaves. The estimated disease severity on P. mamorensis leaves was respectively 75.56% and 68.81% for inoculation by conidial suspension and the mycelial disks. Conidia production of Botrytis cinerea on inoculated leaves by conidial suspension was 1.03.105 conidia.cm-2 and by mycelial disks was 0.60.105 conidia.cm-2. This was the first report of gray mold disease of Mamora pear caused by Botrytis cinerea in Morocco.

Download Full-text