scholarly journals Design and in silico validation of polymerase chain reaction primers to detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Maria Júlia P. Davi ◽  
Selma M. B. Jeronimo ◽  
João P. M. S. Lima ◽  
Daniel C. F. Lanza
Keyword(s):  
Polymerase Chain Reaction ◽  
Severe Acute Respiratory Syndrome ◽  
In Silico ◽  
False Negative ◽  
Pcr Primers ◽  
Virus Genome ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Conserved Regions ◽  
Polymerase Chain

AbstractAccurate designing of polymerase chain reaction (PCR) primers targeting conserved segments in viral genomes is desirable for preventing false-negative results and decreasing the need for standardization across different PCR protocols. In this work, we designed and described a set of primers and probes targeting conserved regions identified from a multiple sequence alignment of 2341 Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) genomes from the Global Initiative on Sharing All Influenza Data (GISAID). We subsequently validated those primers and probes in 211,833 SARS-CoV-2 whole-genome sequences. We obtained nine systems (forward primer + reverse primer + probe) that potentially anneal to highly conserved regions of the virus genome from these analyses. In silico predictions also demonstrated that those primers do not bind to nonspecific targets for human, bacterial, fungal, apicomplexan, and other Betacoronaviruses and less pathogenic sub-strains of coronavirus. The availability of these primer and probe sequences will make it possible to validate more efficient protocols for identifying SARS-CoV-2.

scholarly journals Design and in silico validation of polymerase chain reaction primers to detect severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)

2020 ◽  
Author(s):  
Daniel C. F. Lanza ◽  
João P. M. S. Lima ◽  
Selma M. B. Jerônimo
Keyword(s):  
Polymerase Chain Reaction ◽  
Severe Acute Respiratory Syndrome ◽  
In Silico ◽  
False Negative ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Conserved Regions ◽  
Polymerase Chain

Abstract Accurate designing of polymerase chain reaction (PCR) primers targeting conserved segments in viral genomes is desirable for preventing false negative results and decreasing the need for standardization across different PCR protocols. In this work, we designed and described a set of primers and probes targeting conserved regions identified from a multiple sequence alignment of 2341 Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) genomes from the Global Initiative on Sharing All Influenza Data (GISAID). Those primers and probes were subsequently validated in 3067 SARS-CoV-2 whole-genome sequences. From these analyses, we obtained nine systems (forward primer + reverse primer + probe) that potentially anneal to highly conserved regions of the virus genome. In silico predictions also demonstrated that those primers do not bind to nonspecific targets for human, bacterial, fungal, or apicomplexan sequences. The availability of these primer and probe sequences will make it possible to accelerate the beginning of in vitro tests in order to validate more efficient protocols for the identification of SARS-CoV-2.

scholarly journals A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Plant Disease ◽  
1998 ◽  
Vol 82 (3) ◽  
pp. 285-290 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
K. E. Damann ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Its Region ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Ratoon Stunting Disease ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Sugarcane Ratoon

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

scholarly journals Development of Polymerase Chain Reaction Primers Highly Specific for Xanthomonas albilineans, the Causal Bacterium of Sugarcane Leaf Scald Disease

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 218-222 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
B. L. Legendre ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Bacterial Species ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Leaf Scald ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Xanthomonas Albilineans

New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5′ CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5′ GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.

scholarly journals Digital Droplet PCR for SARS-CoV-2 Resolves Borderline Cases

2021 ◽  
Author(s):  
Jing Xu ◽  
Timothy Kirtek ◽  
Yan Xu ◽  
Hui Zheng ◽  
Huiyu Yao ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Limit Of Detection ◽  
False Negative ◽  
Accurate Method ◽  
Viral Envelope ◽  
Chain Reaction ◽  
Borderline Cases ◽  
Droplet Pcr ◽  
Polymerase Chain ◽  
Digital Polymerase Chain Reaction

Abstract Objectives The Bio-Rad SARS-CoV-2 ddPCR Kit (Bio-Rad Laboratories) was the first droplet digital polymerase chain reaction (ddPCR) assay to receive Food and Drug Administration (FDA) Emergency Use Authorization approval, but it has not been evaluated clinically. We describe the performance of ddPCR—in particular, its ability to confirm weak-positive severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) results. Methods We clinically validated the Bio-Rad Triplex Probe ddPCR Assay. The limit of detection was determined by using serial dilutions of SARS-CoV-2 RNA in an artificial viral envelope. The ddPCR assay was performed according to the manufacturer’s specifications on specimens confirmed to be positive (n = 48) or negative (n = 30) by an FDA-validated reverse transcription–polymerase chain reaction assay on the m2000 RealTime system (Abbott). Ten borderline positive cases were also evaluated. Results The limit of detection was 50 copies/mL (19 of 20 positive). Forty-seven specimens spanning a range of quantification cycles (2.9-25.9 cycle numbers) were positive by this assay (47 of 48; 97.9% positive precent agreement), and 30 negative samples were confirmed as negative (30 of 30; 100% negative percent agreement). Nine of 10 borderline cases were positive when tested in triplicate. Conclusions The ddPCR of SARS-CoV-2 is an accurate method, with superior sensitivity for viral RNA detection. It could provide definitive evaluation of borderline positive cases or suspected false-negative cases.

Demonstration of the indolepyruvate decarboxylase gene homologue in different auxin-producing species of the Enterobacteriaceae

1994 ◽  
Vol 40 (12) ◽  
pp. 1072-1076 ◽  
Author(s):  
Wolfgang Zimmer ◽  
Barbara Hundeshagen ◽  
Edith Niederau
Keyword(s):  
Polymerase Chain Reaction ◽  
Klebsiella Oxytoca ◽  
Pyruvate Decarboxylase ◽  
Enterobacter Agglomerans ◽  
Chain Reaction ◽  
Acetic Acid Production ◽  
Conserved Regions ◽  
Polymerase Chain ◽  
Gene Homologue ◽  
Indole 3 Acetic Acid

Different Enterobacteriaceae were assayed for their ability to produce the plant hormone indole-3-acetate with the aim to study the distribution of the indole-3-pyruvate pathway, which is known to be involved in the production of indole-3-acetate in a root-associated Enterobacter cloacae strain. Other E. cloacae strains, and also Enterobacter agglomerans strains, Pantoea agglomerans, Klebsiella aerogenes, and Klebsiella oxytoca were found to convert tryptophan into indole-3-acetate. As it was also intended to identify the conserved regions of the indole-3-pyruvate decarboxylase, which is involved in producing indole-3-acetate in the E. cloacae strain, oligonucleotide primers were synthesized for different regions of the corresponding gene. One pair of these primers allowed us to amplify a segment of the predicted size by the polymerase chain reaction with DNA of the seven different Enterobacteriaceae that produce indole-3-acetate. Segments of five strains were cloned and sequenced. All sequences showed significant homology to the indole-3-pyruvate decarboxylase gene. As in addition a positive DNA–DNA hybridization signal was detected in the seven strains using the E. cloacae or E. agglomerans segments as a probe, indole-3-acetate biosynthesis is suggested to be catalyzed via the indole-3-pyruvate pathway not only in E. cloacae but also in the other soil-living Enterobacteriaceae. Conserved regions were detected in the indole-3-decarboxylase by alignment of the now-available five different partial sequences. These regions should enable identification of the gene in other bacterial families or even in plants.Key words: indole-3-pyruvate decarboxylase, indole-3-acetic acid production, auxin, polymerase chain reaction, Enterobacteriaceae.

Sign in / Sign up

Export Citation Format

Share Document