scholarly journals Sterol Regulatory Element-binding Protein-1 Interacts with the Nuclear Thyroid Hormone Receptor to Enhance Acetyl-CoA Carboxylase-α Transcription in Hepatocytes

2002 ◽  
Vol 277 (22) ◽  
pp. 19554-19565 ◽  
Author(s):  
Liya Yin ◽  
Yanqiao Zhang ◽  
F. Bradley Hillgartner
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Regulatory Element ◽  
Acetyl Coa Carboxylase ◽  
Acetyl Coa ◽  
Element Binding Protein ◽  
Sterol Regulatory Element

scholarly journals Acetyl-CoA Carboxylase β Gene Is Regulated by Sterol Regulatory Element-binding Protein-1 in Liver

2003 ◽  
Vol 278 (31) ◽  
pp. 28410-28417 ◽  
Author(s):  
So-Young Oh ◽  
Sahng-Kyoo Park ◽  
Jae-Woo Kim ◽  
Yong-Ho Ahn ◽  
Sahng-Wook Park ◽  
...  
Keyword(s):  
Binding Protein ◽  
Regulatory Element ◽  
Acetyl Coa Carboxylase ◽  
Acetyl Coa ◽  
Element Binding Protein ◽  
Sterol Regulatory Element

scholarly journals Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Retinoid X Receptor ◽  
Mrna Levels ◽  
Response Element ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

scholarly journals A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor β

2007 ◽  
Vol 283 (4) ◽  
pp. 2275-2285 ◽  
Author(s):  
Pia Bagamasbad ◽  
Kembra L. Howdeshell ◽  
Laurent M. Sachs ◽  
Barbara A. Demeneix ◽  
Robert J. Denver
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

scholarly journals Hairpin Orientation of Sterol Regulatory Element-binding Protein-2 in Cell Membranes as Determined by Protease Protection

1995 ◽  
Vol 270 (49) ◽  
pp. 29422-29427 ◽  
Author(s):  
Xianxin Hua ◽  
Juro Sakai ◽  
Ho Y. K. ◽  
Joseph L. Goldstein ◽  
Michael S. Brown
Keyword(s):  
Cell Membranes ◽  
Binding Protein ◽  
Regulatory Element ◽  
Element Binding Protein ◽  
Sterol Regulatory Element
Sign in / Sign up

Export Citation Format

Share Document