scholarly journals Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽  
2006 ◽  
Vol 147 (9) ◽  
pp. 4292-4302 ◽  
Author(s):  
Koshi Hashimoto ◽  
Masanobu Yamada ◽  
Shunichi Matsumoto ◽  
Tsuyoshi Monden ◽  
Teturou Satoh ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Retinoid X Receptor ◽  
Mrna Levels ◽  
Response Element ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

scholarly journals Ligand-dependent enhancement of human antithrombin gene expression by retinoid X receptor α and thyroid hormone receptor β

1996 ◽  
Vol 318 (1) ◽  
pp. 263-270 ◽  
Author(s):  
René W. L. M. NIESSEN ◽  
Farhad REZAEE ◽  
Pieter H. REITSMA ◽  
Marjolein PETERS ◽  
Jan J. M. de VIJLDER ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Promoter Region ◽  
Promoter Activity ◽  
Thyroid Hormone Receptor ◽  
Retinoid X Receptor ◽  
Hepatoma Cell Line ◽  
Promoter Fragment ◽  
Thyroid Hormone Receptor Β

We studied potential modulators of antithrombin gene expression. A putative hormone response element (HRE) was identified by sequence similarity analysis of the antithrombin promoter, situated between nucleotides -92 and -54 relative to the transcription start site. This HRE contains three hexanucleotide motifs with an AGGTCA consensus, which are potential targets of members of the steroid/thyroid superfamily of nuclear receptors. Stimulation of the hepatoma cell line HepG2 with the receptor ligands l-3,5,3´-tri-iodothyronine, all-trans retinoic acid, or their combination, increased production of antithrombin into the culture medium by 1.3-, 1.6-, and 2.0-fold, respectively. In contrast, the receptor ligand 1,25-dihydroxycholecalciferol [1,25-(OH)2VitD3] did not influence antithrombin production. Analysis of promoter chloramphenicol acetyltransferase (CAT) constructs, showed that the first 86 bp of the antithrombin promoter region are sufficient for basal transcription. The DNA length polymorphism of 32 bp or 108 bp, located upstream of position -276, did not influence antithrombin promoter activity. The antithrombin promoter activity dropped to background values when deleting the region -97/-49 of promoter fragment -453/+57. Transactivation of the antithrombin promoter by retinoid X receptor α (RXRα) (5–7-fold) or thyroid hormone receptor β (TRβ) (4–5-fold) was only observed when at least -167/+57 bp of the promoter region is present in CAT constructs, and when the appropriate ligand of the nuclear receptor was added. This transactivation was not observed upon deletion of the antithrombin promoter region -97/-49. With three copies of the antithrombin promoter fragment -109/-42 in front of the thymidine kinase minimal promoter, transactivation was only obtained with RXRα, and not with TRβ. In conclusion, these results indicate that the ligand-dependent enhancement of antithrombin gene expression is regulated by RXRα as well as by TRβ. Transactivation of antithrombin gene expression by RXRα and TRβ appears to be dependent upon the presence of promoter region up to nucleotide -167. The HRE segment (-109/-42) only confers RXRα responsiveness to a heterologous promoter. Further study is needed to unravel the exact nature of this HRE and its 5´-flanking sequences.

scholarly journals Thyroid Hormone Induces Hypoxia-Inducible Factor 1α Gene Expression through Thyroid Hormone Receptor β/Retinoid X Receptor α-Dependent Activation of Hepatic Leukemia Factor

Endocrinology ◽  
2008 ◽  
Vol 149 (5) ◽  
pp. 2241-2250 ◽  
Author(s):  
Teresa Otto ◽  
Joachim Fandrey
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Target Genes ◽  
Thyroid Hormone Receptor ◽  
Hypoxia Inducible Factor ◽  
Retinoid X Receptor ◽  
Lung Carcinoma Cells ◽  
Angiogenic Proteins ◽  
Thyroid Hormone Receptor Β

Thyroid hormones are important regulators of differentiation, growth, metabolism, and physiological function of virtually all tissues. Active thyroid hormone T3 affects expression of genes that encode for angiogenic proteins like adrenomedullin or vascular endothelial growth factor and erythropoietin, as well as for glucose transporters and phospho fructokinase that determine glucose use. Interestingly, those target genes are also hypoxia inducible and under the control of the oxygen-dependent transcription factor hypoxia-inducible factor (HIF)-1). We and others have reported that T3 stimulates HIF-1 activation, which intimately links T3 and HIF-1 induced gene expression. Here, we studied intracellular pathways that mediate HIF-1α regulation by T3. We found that T3-dependent HIF-1 activation is not limited to hepatoma cells but is also observed in primary human hepatocytes, kidney and lung carcinoma cells. T3 increased the HIF-1α subunit mRNA and protein within a few hours through activation of the thyroid hormone receptor β retinoid X receptor α heterodimer because knockdown of each of the partners abrogated the stimulation by T3. However, T3 had no direct effect on transcription of HIF-1α, but activation of the thyroid hormone receptor β/retinoid X receptor α heterodimer by T3 stimulated expression of the hepatic leukemia factor, which increases HIF-1α gene expression.

scholarly journals A Role for Basic Transcription Element-binding Protein 1 (BTEB1) in the Autoinduction of Thyroid Hormone Receptor β

2007 ◽  
Vol 283 (4) ◽  
pp. 2275-2285 ◽  
Author(s):  
Pia Bagamasbad ◽  
Kembra L. Howdeshell ◽  
Laurent M. Sachs ◽  
Barbara A. Demeneix ◽  
Robert J. Denver
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Binding Protein ◽  
Element Binding Protein ◽  
Thyroid Hormone Receptor Β

scholarly journals Thyroid Hormone-mediated Enhancement of Heterodimer Formation between Thyroid Hormone Receptor β and Retinoid X Receptor

1997 ◽  
Vol 272 (20) ◽  
pp. 13060-13065 ◽  
Author(s):  
Trevor N. Collingwood ◽  
Alison Butler ◽  
Yukiko Tone ◽  
Rory J. Clifton-Bligh ◽  
Malcolm G. Parker ◽  
...  
Keyword(s):  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Retinoid X Receptor ◽  
Thyroid Hormone Receptor Β

scholarly journals Carbohydrate Response Element Binding Protein Gene Expression Is Positively Regulated by Thyroid Hormone

Endocrinology ◽  
2009 ◽  
Vol 150 (7) ◽  
pp. 3417-3424 ◽  
Author(s):  
Koshi Hashimoto ◽  
Emi Ishida ◽  
Shunichi Matsumoto ◽  
Shuichi Okada ◽  
Masanobu Yamada ◽  
...  
Keyword(s):  
Gene Expression ◽  
Thyroid Hormone ◽  
Target Genes ◽  
Binding Protein ◽  
Gene Promoter ◽  
Direct Repeat ◽  
Transcriptional Level ◽  
Hepatic Lipogenesis ◽  
Response Element ◽  
Element Binding Protein

The molecular mechanism of thyroid hormone (TH) effects to fatty acid metabolism in liver is yet to be clear. The carbohydrate response element-binding protein (ChREBP) as well as sterol response element-binding protein (SREBP)-1c plays a pivotal role in hepatic lipogenesis. Both SREBP-1c and ChREBP are target genes of liver X receptors (LXRs). Because LXRs and TH receptors (TRs) cross talk mutually in many aspects of transcription, we examined whether TRs regulate the mouse ChREBP gene expression. In the current study, we demonstrated that TH up-regulated mouse ChREBP mRNA and protein expression in liver. Run-on and luciferase assays showed that TH and TR-β1 positively regulated the ChREBP gene transcription. The mouse ChREBP gene promoter contains two direct repeat-4 sites (LXRE1 and LXRE2) and EMSAs demonstrated that LXR-α and TR-β1 prefer to bind LXRE1 and LXRE2, respectively. The direct repeat-4 deletion and LXRE2 mutants of the promoter deteriorate the positive regulation by TR-β1, indicating that LXRE2 is functionally important for the regulation. We also showed that human ChREBP gene expression and promoter activities were up-regulated by TH. These data suggest that ChREBP mRNA expression is positively regulated by TR-β1 and TH at the transcriptional level in mammals. This novel observation indicates that TH fine-tunes hepatic lipogenesis via regulating SREBP-1c and ChREBP gene expression reciprocally.

scholarly journals Aberrant Expression of Thyroid Hormone Receptor β Isoform May Cause Inappropriate Secretion of TSH in a TSH-Secreting Pituitary Adenoma

2011 ◽  
Vol 96 (6) ◽  
pp. E948-E952 ◽  
Author(s):  
Tetsuya Tagami ◽  
Takeshi Usui ◽  
Akira Shimatsu ◽  
Mutsuo Beniko ◽  
Hiroyuki Yamamoto ◽  
...  
Keyword(s):  
Gene Expression ◽  
Pituitary Adenoma ◽  
Thyroid Hormone ◽  
Hormone Receptor ◽  
Thyroid Hormone Receptor ◽  
Transient Gene Expression ◽  
Negative Regulation ◽  
Aberrant Expression ◽  
Inappropriate Secretion ◽  
Thyroid Hormone Receptor Β

Context: Patients with TSH-secreting pituitary adenomas (TSHoma) show inappropriate secretion of TSH; serum TSH levels are not suppressed despite high serum free thyroid hormone levels. The mechanism of a defect in negative regulation of TSH in a TSHoma is still unclear. Objective: Recently, we cloned a novel thyroid hormone receptor β isoform (TRβ4) from a human pituitary library. To elucidate the clinical significance of TRβ4, we investigated the expression of this isoform in TSHoma. Methods: RT-PCR was performed to detect TRβ isoforms such as TRβ1, TRβ2, and TRβ4 using RNA obtained from surgically resected TSHoma. The effects of TRβ4 on the TSH gene expression were examined in the transient gene expression experiments. Results: Quantitative analysis using a real-time PCR revealed that relative expression of TRβ4 to TRβ1+2 was higher in three TSHoma than in a prolactinoma or a nonfunctioning pituitary adenoma. TRβ4 construct did not mediate T3-dependent gene regulation but inhibited the negative regulation of TSHα mediated by TRβ1 or TRβ2. Conclusions: Aberrant expression of TRβ4 may partly contribute to the inappropriate secretion of TSH in a TSHoma.

Sign in / Sign up

Export Citation Format

Share Document