Human Homolog of Drosophila Heterochromatin-Associated Protein 1 (HP1) Is a DNA-Binding Protein Which Possesses a DNA-Binding Motif with Weak Similarity to That of Human Centromere Protein C (CENP-C)

1996 ◽  
Vol 120 (1) ◽  
pp. 153-159 ◽  
Author(s):  
K. Sugimoto ◽  
T. Yamada ◽  
Y. Muro ◽  
M. Himeno
Keyword(s):  
Dna Binding ◽  
Protein C ◽  
Binding Protein ◽  
Dna Binding Protein ◽  
Binding Motif ◽  
Human Homolog ◽  
Human Centromere ◽  
Centromere Protein ◽  
Drosophila Heterochromatin ◽  
Weak Similarity

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals The DUF328 family member YaaA is a DNA-binding protein with a novel fold

2020 ◽  
Vol 295 (41) ◽  
pp. 14236-14247
Author(s):  
Janani Prahlad ◽  
Yifeng Yuan ◽  
Jiusheng Lin ◽  
Chou-Wei Chang ◽  
Dirk Iwata-Reuyl ◽  
...  
Keyword(s):  
Oxidative Stress ◽  
Dna Repair ◽  
Stress Response ◽  
Dna Binding ◽  
Binding Protein ◽  
Equilibrium Constants ◽  
Dna Recombination ◽  
Dna Binding Protein ◽  
Oxidative Stress Response ◽  
Binding Motif

DUF328 family proteins are present in many prokaryotes; however, their molecular activities are unknown. The Escherichia coli DUF328 protein YaaA is a member of the OxyR regulon and is protective against oxidative stress. Because uncharacterized proteins involved in prokaryotic oxidative stress response are rare, we sought to learn more about the DUF328 family. Using comparative genomics, we found a robust association between the DUF328 family and genes involved in DNA recombination and the oxidative stress response. In some proteins, DUF328 domains are fused to other domains involved in DNA binding, recombination, and repair. Cofitness analysis indicates that DUF328 family genes associate with recombination-mediated DNA repair pathways, particularly the RecFOR pathway. Purified recombinant YaaA binds to dsDNA, duplex DNA containing bubbles of unpaired nucleotides, and Holliday junction constructs in vitro with dissociation equilibrium constants of 200–300 nm. YaaA binds DNA with positive cooperativity, forming multiple shifted species in electrophoretic mobility shift assays. The 1.65-Å resolution X-ray crystal structure of YaaA reveals that the protein possesses a new fold that we name the cantaloupe fold. YaaA has a positively charged cleft and a helix-hairpin-helix DNA-binding motif found in other DNA repair enzymes. Our results demonstrate that YaaA is a new type of DNA-binding protein associated with the oxidative stress response and that this molecular function is likely conserved in other DUF328 family members.

A lateral flow biosensor for rapid detection of DNA-binding protein c-jun

2011 ◽  
Vol 27 (1) ◽  
pp. 192-196 ◽  
Author(s):  
Zhiyuan Fang ◽  
Chenchen Ge ◽  
Wenjuan Zhang ◽  
Puchang Lie ◽  
Lingwen Zeng
Keyword(s):  
Dna Binding ◽  
Rapid Detection ◽  
Protein C ◽  
Binding Protein ◽  
Dna Binding Protein ◽  
Lateral Flow

scholarly journals A Centromere DNA-binding Protein from Fission Yeast Affects Chromosome Segregation and Has Homology to Human CENP-B

1997 ◽  
Vol 136 (3) ◽  
pp. 487-500 ◽  
Author(s):  
Dana Halverson ◽  
Mary Baum ◽  
Janet Stryker ◽  
John Carbon ◽  
Louise Clarke
Keyword(s):  
Dna Binding ◽  
Fission Yeast ◽  
Mitotic Chromosome ◽  
Binding Protein ◽  
Chromosome Instability ◽  
Dna Binding Protein ◽  
Autonomously Replicating Sequence ◽  
Human Centromere ◽  
Chromosome Ii

Genetic and biochemical strategies have been used to identify Schizosaccharomyces pombe proteins with roles in centromere function. One protein, identified by both approaches, shows significant homology to the human centromere DNA-binding protein, CENP-B, and is identical to Abp1p (autonomously replicating sequence-binding protein 1) (Murakami, Y., J.A. Huberman, and J. Hurwitz. 1996. Proc. Natl. Acad. Sci. USA. 93:502–507). Abp1p binds in vitro specifically to at least three sites in centromeric central core DNA of S. pombe chromosome II (cc2). Overexpression of abp1 affects mitotic chromosome stability in S. pombe. Although inactivation of the abp1 gene is not lethal, the abp1 null strain displays marked mitotic chromosome instability and a pronounced meiotic defect. The identification of a CENP-B–related centromere DNA-binding protein in S. pombe strongly supports the hypothesis that fission yeast centromeres are structurally and functionally related to the centromeres of higher eukaryotes.

Sign in / Sign up

Export Citation Format

Share Document