Regulation of Tomato Leaf Curl Viral Gene Expression in Host Tissues

The regulation of expression of the two virion-sense (V1 and V2) and four complementary-sense (C1, C2, C3, and C4) open reading frames (ORFs) of Tomato leaf curl virus (TLCV) was studied in both stably and transiently transformed Nicotiana tabacum tissues with fusions with the β-glucuronidase (GUS) reporter gene. GUS-expressing transgenic lines were obtained with each of the four complementary-sense gene-GUS fusion constructs and with truncated versions of the virion-sense gene-GUS fusion constructs (V1GUSΔC and V2GUSΔC) lacking complementary-sense sequences encoding the C1, C2, and C3 ORFs. However, little or no GUS expression was observed in kanamycin-resistant plants transformed with full-length, virion-sense gene constructs (V1GUS and V2GUS) constituting the complete viral genome. In contrast, V1GUS and V2GUS were found to direct high-level GUS expression in transient assays with tobacco protoplasts, suggesting that integration of viral constructs containing functional, complementary-sense genes may lead to repression or deletion of the introduced constructs in trans-genic tissues. V2GUS expression in the transient proto-plast assay was found to be severely curtailed by specific mutation of the C2 ORF, supporting a role for the C2 protein in transactivation of TLCV virion-sense gene expression. TLCV ORF-GUS constructs displayed distinctive tissue expression patterns in transgenic tobacco plants that could be divided into constitutive (C1, C4, and V2GUSΔC), predominantly vascular (C2, C3), or reduced expression in cells associated with the vascular bundles (V1GUSΔC). The significance of these results is discussed in terms of current models of gene function and regulation in geminiviruses.

Download Full-text

First Report of Tomato leaf curl Albatinah virus (ToLCABV) and its Associated Betasatellite Infecting Papaya in Oman

Plant Disease ◽

10.1094/pdis-09-14-0912-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 421-421 ◽

Cited By ~ 1

Author(s):

U. E. Ammara ◽

A. Al-Shihi ◽

I. Amin ◽

A. M. Al-Sadi

Keyword(s):

Coat Protein ◽

Tomato Leaf ◽

Transcription Activator ◽

Sequence Identity ◽

Sense Strand ◽

Virion Sense ◽

Tomato Leaf Curl ◽

Leaf Curl Disease ◽

Complementary Sense ◽

Leaf Curl

Leaf curl disease with severe curling, vein darkening, and vein thickening was observed on papaya plants in a field in Qurayat district of Oman during December 2013. Disease incidence ranged from 50 to 70%, particularly in young papaya plants. The presence of a large population of whiteflies and symptoms observed on papaya plants suggested that the causal agent could be begomoviruses (family Geminiviridae) and associated satellites. Four leaf samples with mild and severe leaf curling were collected from the field. Total nucleic acid extracted from symptomatic and healthy plants using the CTAB method were used as a template to amplify circular DNAs using Φ29 DNA polymerase, and products were digested with restriction enzymes to identify fragments of 2.6 to 2.8 kb typical of geminiviruses. BamHI yielded fragments of ~2.8 and 1.4 kb when the digested products were resolved by electrophoresis on a 1% agarose gel. These fragments were cloned and sequenced using a primer walking strategy in both directions. Sequencing results confirmed the exact sizes of 1,303, 1,358, and 2,765 bp; the sequences were deposited in GenBank under the accession numbers HG969296, HG969297, and HG969260, respectively. BLAST results showed that the first two sequences are Tomato leaf curl betasatellite (ToLCB; isolates Pap-2 and Pap-3) showing 97% sequence identity with a previously reported ToLCB sequence (Accession No. KF229728). Both satellites encode a single gene in the complementary sense strand referred to as βC1, which showed 97% sequence identity to ToLCB (HE800551). The viral sequence (isolate Pap-6) showed four genes in the complementary sense (the replication-associated protein [Rep] gene, the transcription-activator protein [TrAP] gene, the replication-enhancer protein [REn] gene, and the C4 gene) and two genes (pre-coat protein [V2] and coat protein [CP]) in virion-sense (2). BLAST analysis showed 95.2% sequence identity to Tomato leaf curl Albatinah virus (ToLCABV; FJ956700), reported earlier to infect tomato in Oman (3). Amino acid sequence comparison of the four predicted proteins (Rep, TrAP, Ren, and C4) encoded by Pap-6 shared 95, 96, 100, and 100% sequence identity, whereas virion-sense proteins (V1 and V2) shared 99% sequence identity with ToLCABV (FJ956700). According to the recommendations of the International Committee on Taxonomy of Viruses, these results indicate that the virus identified in association with papaya leaf curl disease in Oman is a variant of ToLCABV (1). All infected samples showed the presence of ToLCABV, while no hybridization was observed in healthy control DNA using ToLCABV probe. These findings are indicative of the rapid spread of diseases involving Begomovirus and betasatellites, which often result in increased host range, as is evident from this study. References: (1) C. M. Fauquet et al. Arch. Virol. 148:405, 2003. (2) L. Hanley-Bowdoin et al. Crit. Rev. Plant Sci. 18:71, 1999. (3) A. J. Khan et al. Arch. Virol. 159:445, 2013.

Download Full-text

Evidence that Watermelon Leaf Curl Disease in Pakistan Is Associated with Tomato Leaf Curl Virus-India, a Bipartite Begomovirus

Plant Disease ◽

10.1094/pdis.2000.84.1.102a ◽

2000 ◽

Vol 84 (1) ◽

pp. 102-102 ◽

Cited By ~ 15

Author(s):

S. Mansoor ◽

S. H. Khan ◽

M. Hussain ◽

N. Mushtaq ◽

Y. Zafar ◽

...

Keyword(s):

Southern Hybridization ◽

Tomato Leaf ◽

Tomato Leaf Curl Virus ◽

Virion Sense ◽

Tomato Leaf Curl ◽

Leaf Curl Virus ◽

Leaf Curl Disease ◽

Complementary Sense ◽

Full Length Clone ◽

Leaf Curl

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

Mutagenesis of the Virion-Sense Open Reading Frames of Tomato Leaf Curl Geminivirus

Virology ◽

10.1006/viro.1993.1215 ◽

1993 ◽

Vol 193 (2) ◽

pp. 1001-1005 ◽

Cited By ~ 47

Author(s):

Justin E. Rigden ◽

Ian B. Dry ◽

Philip M. Mullineaux ◽

M.Ali Rezaian

Keyword(s):

Tomato Leaf ◽

Open Reading Frames ◽

Virion Sense ◽

Tomato Leaf Curl ◽

Reading Frames ◽

Leaf Curl

Download Full-text

Mechanism of regulation of tomato TRN1 gene expression in late infection with tomato leaf curl New Delhi virus (ToLCNDV)

Plant Science ◽

10.1016/j.plantsci.2015.10.008 ◽

2015 ◽

Vol 241 ◽

pp. 221-237 ◽

Cited By ~ 9

Author(s):

Arunava Mandal ◽

Deepti Sarkar ◽

Surekha Kundu ◽

Pallob Kundu

Keyword(s):

Gene Expression ◽

Tomato Leaf ◽

New Delhi ◽

Late Infection ◽

Tomato Leaf Curl ◽

Leaf Curl

Download Full-text

Screening Luffa germplasm and advanced breeding lines for resistance to Tomato leaf curl New Delhi virus

Journal of General Plant Pathology ◽

10.1007/s10327-021-01010-z ◽

2021 ◽

Author(s):

Manpreet Kaur ◽

B. Varalakshmi ◽

M. Pitchaimuthu ◽

B. Mahesha

Keyword(s):

Tomato Leaf ◽

New Delhi ◽

Breeding Lines ◽

Tomato Leaf Curl ◽

Leaf Curl

Download Full-text

Potato apical leaf curl disease: current status and perspectives on a disease caused by tomato leaf curl New Delhi virus

Journal of Plant Diseases and Protection ◽

10.1007/s41348-021-00463-w ◽

2021 ◽

Author(s):

Ravinder Kumar ◽

Rahul Kumar Tiwari ◽

Arjunan Jeevalatha ◽

Sundaresha Siddappa ◽

Mohd. Abas Shah ◽

...

Keyword(s):

Tomato Leaf ◽

Current Status ◽

New Delhi ◽

Apical Leaf ◽

Tomato Leaf Curl ◽

Leaf Curl Disease ◽

Leaf Curl

Download Full-text

Metagenomic analyses and genetic diversity of Tomato leaf curl Arusha virus affecting tomato plants in Kenya

Virology Journal ◽

10.1186/s12985-020-01466-z ◽

2021 ◽

Vol 18 (1) ◽

Author(s):

Edith Khamonya Avedi ◽

Adedapo Olutola Adediji ◽

Dora Chao Kilalo ◽

Florence Mmogi Olubayo ◽

Isaac Macharia ◽

...

Keyword(s):

Genetic Diversity ◽

Selection Pressure ◽

Management Strategies ◽

Purifying Selection ◽

Tomato Leaf ◽

Amino Acid Sequences ◽

Virus Population ◽

Tomato Production ◽

Tomato Leaf Curl ◽

Leaf Curl

Abstract Background Tomato production is threatened worldwide by the occurrence of begomoviruses which are associated with tomato leaf curl diseases. There is little information on the molecular properties of tomato begomoviruses in Kenya, hence we investigated the population and genetic diversity of begomoviruses associated with tomato leaf curl in Kenya. Methods Tomato leaf samples with virus-like symptoms were obtained from farmers’ field across the country in 2018 and Illumina sequencing undertaken to determine the genetic diversity of associated begomoviruses. Additionally, the occurrence of selection pressure and recombinant isolates within the population were also evaluated. Results Twelve complete begomovirus genomes were obtained from our samples with an average coverage of 99.9%. The sequences showed 95.7–99.7% identity among each other and 95.9–98.9% similarities with a Tomato leaf curl virus Arusha virus (ToLCArV) isolate from Tanzania. Analysis of amino acid sequences showed the highest identities in the regions coding for the coat protein gene (98.5–100%) within the isolates, and 97.1–100% identity with the C4 gene of ToLCArV. Phylogenetic algorithms clustered all Kenyan isolates in the same clades with ToLCArV, thus confirming the isolates to be a variant of the virus. There was no evidence of recombination within our isolates. Estimation of selection pressure within the virus population revealed the occurrence of negative or purifying selection in five out of the six coding regions of the sequences. Conclusions The begomovirus associated with tomato leaf curl diseases of tomato in Kenya is a variant of ToLCArV, possibly originating from Tanzania. There is low genetic diversity within the virus population and this information is useful in the development of appropriate management strategies for the disease in the country.

Download Full-text