First Report of Fludioxonil Resistance in Botrytis cinerea from a Strawberry Field in Virginia

Gray mold caused by Botrytis cinerea Pers.:Fr. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. Control of gray mold mainly depends on fungicides, including the phenylpyrrole fludioxonil, which is currently marketed in combination with cyprodinil as Switch 62.5WG (Syngenta Crop Protection, Research Triangle Park, Raleigh, NC). In 2012, 790 strains of B. cinerea were collected from 76 strawberry fields in eight states, including Arkansas, Florida, Georgia, Kansas, Maryland, North Carolina, South Carolina, and Virginia. Strains were collected from sporulating flowers and fruit and sensitivity to fludioxonil was determined using a conidial germination assay as previously described (2). Only one isolate from a farm located in Westmoreland County, Virginia, grew on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and was therefore considered low resistant. The isolate did not grow on 10 μg/ml. All other 789 isolates did not grow at either of the two doses. This assay was repeated twice with a single-spore culture of the same strain. In both cases, residual growth was observed on the fludioxonil-amended medium of 0.1 μg/ml. The single spore isolate was confirmed to be B. cinerea Pers. using cultural and molecular tools as described previously (1). To assess resistance in vivo, commercially grown ripe strawberry fruit were rinsed with sterile water, dried, placed into plastic boxes (eight strawberries per box for each of the three replicates per treatment), and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of fludioxonil (Scholar SC, Syngenta) to runoff using a hand mister. This dose reflects the rate recommended for gray mold control according to the Scholar label. Each fruit was stabbed at three equidistant points, each about 1 cm apart and 1 cm deep using a syringe tip. Wounds were injected with a 30-μl droplet of conidia suspension (106 spores/ml) of either 5 sensitive or the resistant isolate. Control fruit were inoculated with water. After inoculation, the fruit were kept at 22°C for 4 days. In two independent experiments, sensitive and low resistant isolates were indistinguishable in pathogenicity on detached, unsprayed fruit. The low resistant isolate developed gray mold disease on all treated and untreated fruit (100% disease incidence) as determined by the absence or presence of gray mold symptoms. The sensitive isolates only developed disease on untreated fruit. The EC50 values, determined in microtiter assays with concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μg/ml fludioxonil, were 0.01 μg/ml for the sensitive isolates and 0.26 μg/ml for the resistant isolate. To our knowledge, this is the first report of fludioxonil resistance in B. cinerea from strawberry in North America. Our monitoring results indicate that resistance is emerging 10 years after the introduction of fludioxonil and stress the importance of chemical rotation for gray mold control. References: (1) X. P. Li et al. Plant Dis. 96:1634, 2012. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽

10.1094/pdis-07-11-0543 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1481-1481

Author(s):

F. P. Chen ◽

X. L. Liu ◽

X. P. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Gray Mold ◽

Resistant Isolate ◽

Cross Resistance ◽

Broad Host Range ◽

Paper Strip ◽

Single Spore ◽

First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Blackberry Field in Georgia

Plant Disease ◽

10.1094/pdis-10-13-1020-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 848-848 ◽

Cited By ~ 6

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

E. D. Beasley ◽

L. A. Fall ◽

...

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Resistant Isolate ◽

Malt Extract ◽

First Report ◽

Control Fruit ◽

Lesion Diameter

Botrytis cinerea Pers. is an important plant-pathogenic fungi responsible for gray mold on more than 230 plant species worldwide, including blackberry (Rubus). One of the main strategies to control the disease involves the application of different classes of fungicides. The phenylpyrrole fludioxonil is currently marketed in combination with the anilinopyrimidine cyprodinil as Switch 62.5WG (Syngenta Crop Protection Inc., Greensboro, NC) for gray mold control. In August 2013, blackberries affected with symptoms resembling gray mold were collected from a field located in Berrien County (Georgia), where Switch 62.5WG had been used extensively over the last 5 years. Three single-spore isolates, each from a different fruit, were obtained and identified as B. cinerea on the basis of morphology and confirmed by a 238-bp PCR amplification product obtained with primer set G3PDH-F1 (5′-GGACCCGAGCTAATTTATGTCACGT-3′), G3PDH-F2 (5′-GGGTGTCAACAACGAGACCTACACT-3′), and G3PDH-R (5′-ACCGGTGCTCGATGGGATGAT-3′). In vitro sensitivity to fludioxonil (Scholar SC, Syngenta) was determined on 1% malt extract agar (MEA) using a conidial germination assay as previously described (4). One isolate was moderately resistant due to growth on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and residual growth at 10 μg/ml (4). To assess performance of fludioxonil in detached fruit assays, commercially grown strawberries (24 in total for each isolate and treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water (control fruit) or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Scholar SC was used because fludioxonil was the sole active ingredient in this product and strawberries were used because latent infections in fresh blackberry fruit interfered with inoculation experiments. This dose reflects the rate recommended for postharvest gray mold control according to the Scholar label. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of the two sensitive or the resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolates developed gray mold on non-treated (2.7 cm lesion diameter) but not on Scholar SC-treated fruit (0.0 cm lesion diameter). The resistant isolate developed gray mold disease on the water-treated control fruit (2.5 cm lesion diameter) and the fungicide-treated fruit (1.8 cm lesion diameter). EC50 values were determined in microtiter assays as described previously (3) using the concentrations of 0.01, 0.04, 0.12, 0.37, 1.1, 3.3, and 10 μg/ml fludioxonil. Values were 0.02 and 0.05 μg/ml for the two sensitive isolates and 3.15 μg/ml for the resistant isolate. All experiments were performed twice. This is the first report of fludioxonil resistance in B. cinerea from blackberry in Georgia. Prior to this study, resistance to fludioxonil in B. cinerea was reported in France, Germany, and only a few states in the United States including Maryland, South Carolina, Virginia, and Washington (1,2). The emergence of resistance to fludioxonil emphasizes the importance of resistance management strategies. References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 98:692, 2013. (3) M. Kretschmer et al. PLOS Pathog. 5:e1000696, 2009. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea, the Causal Agent of Gray Mold, from Strawberry Fields in Maryland and South Carolina

Plant Disease ◽

10.1094/pdis-08-13-0875-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 692-692 ◽

Cited By ~ 8

Author(s):

D. Fernández-Ortuño ◽

A. Grabke ◽

P. K. Bryson ◽

R. J. Rouse ◽

P. Rollins ◽

...

Keyword(s):

United States ◽

South Carolina ◽

Botrytis Cinerea ◽

Crop Protection ◽

The United States ◽

Gray Mold ◽

Causal Agent ◽

First Report ◽

Lesion Diameter

Botrytis cinerea Pers. is the causal agent of gray mold and one of the most economically important plant-pathogenic fungi affecting strawberry (Fragaria × ananassa). Control of gray mold mainly depends on the use of site-specific fungicides, including the phenylpyrrole fludioxonil. This fungicide is currently registered in combination with cyprodinil in form of Switch 62.5WG (Syngenta Crop Protection, Greensboro, NC) for gray mold control of small fruits in the United States. In June 2013, strawberries affected with symptoms resembling gray mold were observed despite the application of Switch in one field located in Federalsburg, MD, and one located near Chesnee, SC. Ten single-spore isolates, each from a different fruit, were obtained from each location and confirmed to be B. cinerea using cultural and molecular tools as described previously (3). In vitro sensitivity to fludioxonil (Scholar SC, 20.4% [v/v] active ingredient, Syngenta Crop Protection, Greensboro, NC) was determined using a conidial germination assay as previously described (4). Eight of the 20 isolates (six from Maryland and two from South Carolina) were moderately resistant to fludioxonil, i.e., they grew on medium amended with 0.1 μg/ml fludixonil and showed residual growth at 10 μg/ml (4). The in vitro assay was repeated obtaining the same results. To assess in vivo sensitivity on fungicide-treated fruit, commercially grown strawberries were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of Scholar SC to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of conidia suspension (106 spores/ml) of either two sensitive or four resistant isolates (two isolates from Maryland and two isolates from South Carolina). Each isolate/treatment combination consisted of 24 mature but still firm strawberry fruit with three 8-fruit replicates. The fruit were kept at 22°C and lesion diameters were measured after 4 days of inoculation. The sensitive isolates developed gray mold symptoms on nontreated (2.5 cm lesion diameter) but not on Scholar SC-treated fruit. The resistant isolates developed gray mold on both, the water-treated control (2.3 cm lesion diameter), and the fungicide-treated fruit (1.8 cm lesion diameter). The experiment was performed twice. To our knowledge this is the first report of fludioxonil resistance in B. cinerea from strawberry fields in Maryland and South Carolina. Resistance to fludioxonil is still rare in the United States and has only been reported in B. cinerea isolates from a Virginia strawberry field (1). The increase in occurrence of resistance to fludioxonil may be a result of increased use of Switch following reports of resistance to other chemical classes in this pathogen in southern strawberry fields (2). References: (1) D. Fernández-Ortuño et al. Plant Dis. 97:848, 2013. (2) D. Fernández-Ortuño et al. Plant Dis. 96:1198, 2012. (3) D. Fernández-Ortuño et al. Plant Dis. 95:1482, 2011. (4) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Fenpyrazamine Resistance in Botrytis cinerea from Strawberry Fields in Spain

Plant Health Progress ◽

10.1094/php-12-17-0075-br ◽

2018 ◽

Vol 19 (1) ◽

pp. 45-45

Author(s):

Dolores Fernández-Ortuño ◽

Alejandra Vielba-Fernández ◽

Alejandro Pérez-García ◽

Juan A. Torés ◽

Antonio de Vicente

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

In Vivo Studies ◽

Cross Resistance ◽

In Vitro Tests ◽

Class Iii ◽

Single Spore ◽

First Report

Botrytis cinerea Pers. is an important fungal pathogen responsible for gray mold, one of the most economically important diseases of strawberry (Fragaria × ananassa) worldwide. The primary disease management strategy involves the application of different classes of fungicides, including the sterol biosynthesis inhibitor class III fungicide fenpyrazamine. In 2014 and 2015, strawberries affected with gray mold symptoms were collected from eight locations in Huelva, where fenhexamid had been used extensively. Twenty-five B. cinerea single-spore isolates were examined to determine EC50 values and to determine a discriminatory dose to monitor fenpyrazamine resistance in the field in future studies. The in vitro tests divided the isolates into two groups: 15 sensitive (EC50 from 0.02 to 1.3 μg/ml) and 10 resistant (EC50 from 50.1 to 172.6 μg/ml), which showed cross-resistance with fenhexamid. Performance of fenpyrazamine in in vivo studies was also carried out. Only the fenpyrazamine-resistant isolates developed gray mold on the fungicide-treated fruit. This is the first report of fenpyrazamine resistance in B. cinerea from strawberry fields in Spain and cross-resistance with fenhexamid.

Download Full-text

First Report of Thiophanate-Methyl Resistance in Botrytis cinerea on Strawberry from South Carolina

Plant Disease ◽

10.1094/pdis-06-12-0557-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1700-1700 ◽

Cited By ~ 8

Author(s):

D. Fernández-Ortuño ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Fungicide Resistance ◽

Pathogenic Fungi ◽

Gray Mold ◽

Resistant Isolate ◽

Conidial Suspension ◽

Strawberry Fruit ◽

Single Spore ◽

Thiophanate Methyl

Botrytis cinerea Pers.:Fr. is the causal agent of gray mold disease and one of the most important plant-pathogenic fungi affecting strawberry (Fragaria× ananassa). Control of gray mold mainly depends on fungicides, including the methyl benzimidazole carbamate (MBC) thiophanate-methyl. In 2011, strawberries with gray mold symptoms were collected from commercial fields near Chesnee, Florence, Lexington, McBee, Monetta, and North Augusta, all in South Carolina. MBC fungicides were used in most of these fields for gray mold control during the last 3 years. A total of 124 single spore B. cinerea isolates were obtained, each from a different fruit. Resistance to thiophanate-methyl (Topsin M 70WP, Cerexagri-Nisso LLC, King of Prussia, PA) was determined using a conidial germination assay as described previously (1). The majority of isolates (81.4%) were resistant; the rest were sensitive. Resistant isolates were found in all locations with some populations (Chesnee, McBee, and Lexington) revealing no sensitive isolates. Genomic DNA from 35 resistant isolates (representing all locations) and 10 sensitive isolates (from Chesnee, Monetta, and North Augusta, SC) was extracted, and the molecular basis of MBC fungicide resistance was determined as described previously (2). All MBC-resistant isolates possessed the E198A mutation known to confer high levels of MBC fungicide resistance in many fungi, including B. cinerea (2,3). Disease was assessed using a detached strawberry fruit assay. Commercially grown strawberry fruit (24 in total for each isolate and fungicide treatment) were rinsed with water, dried, and sprayed 4 h prior to inoculation with either water or 2.4 g/liter of Topsin M to runoff using a hand mister. Fruit was stab-wounded with a sterile syringe and inoculated with a 30-μl droplet of a conidial suspension (106 spores/ml) of either a sensitive or resistant isolate. After inoculation, the fruit were kept at 22°C for 4 days. The sensitive isolate developed gray mold disease in untreated but not Topsin M-treated fruit. The resistant isolate developed gray mold disease of equal severity in both, the control and fungicide-treated fruit. This experiment was repeated once. The results of the study show that resistance to MBC fungicides is common and widespread in B. cinerea from strawberry in South Carolina. Prior to this study, resistance to MBCs has only been reported in B. cinerea from ornamental crops grown in greenhouses in South Carolina (4). References: (1) J. E. Luck and M. R. Gillings. Mycol. Res. 99:1483, 1995. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011. (3) O. Yarden and T. Katan. Phytopathology 83:1478, 1993. (4) L. F. Yourman and S. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽

10.1094/pd-89-0910c ◽

2005 ◽

Vol 89 (8) ◽

pp. 910-910 ◽

Cited By ~ 2

Author(s):

J. E. Woodward ◽

T. B. Brenneman ◽

R. C. Kemerait ◽

A. K. Culbreath ◽

J. R. Clark

Keyword(s):

Botrytis Cinerea ◽

Disease Incidence ◽

Block Design ◽

Gray Mold ◽

American Phytopathological Society ◽

Breeding Programs ◽

First Report ◽

Tomato Spotted Wilt ◽

Arachis Hypogaea L ◽

Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

Download Full-text

First Report of Armillaria tabescens Causing Armillaria Root Rot of Pindo Palm in South Carolina

Plant Disease ◽

10.1094/pd-90-1106a ◽

2006 ◽

Vol 90 (8) ◽

pp. 1106-1106 ◽

Cited By ~ 3

Author(s):

G. Schnabel ◽

P. K. Bryson ◽

M. A. Williamson

Keyword(s):

South Carolina ◽

Selective Medium ◽

Plant Diseases ◽

Universal Primers ◽

Its2 Region ◽

Palm Tree ◽

Single Spore ◽

First Report ◽

Single Spore Isolate ◽

Palm Trees

A Pindo palm tree (Butia capitata) declined in a commercial landscape setting in Georgetown, SC during June of 2005. In the spring, after looking healthy the previous year, the entire canopy collapsed with leaves attached. The canopy defoliated shortly thereafter. A cross section through primary and secondary roots of the wilting plant revealed necrotic areas with the presence of white mycelial fans. Diseased roots containing mycelial fans were collected and small sections were transferred to benomyl dichloran streptomycin (BDS) selective medium. Fungal cultures grew approximately 1 mm in diameter per day and developed aeriel mycelium first. Later, cultures developed mainly crustose mycelium with some parts being aerial. Ribosomal internal transcribed spacer (ITS) regions 1 and 2 were polymerase chain reaction amplified with universal primers ITS1-F and ITS4 and sequenced (GenBank Accession No. DQ109806). A BLAST search in GenBank of the ITS1-5.8S-ITS2 region identified the pathogen as Armillaria tabescens (Scop.) Emel (synonym Clitocybe tabescens (Fr.) Bres) with 98% sequence homology to A. tabescens single-spore isolate ss23 from South Carolina (Accession No. AY695408). The diploid culture from the roots of the Pindo palm was compatible with haploid tester strains of A. tabescens as indicated by diploidization of the haploid mycelium. The disease has been reported on Pindo palm in Florida (1), but to our knowledge, this is the first report of A. tabescens causing disease on Butia species in South Carolina. Our findings indicate that Pindo palm trees could be at risk for infection and should not be cultivated in soils containing pathogenic Armillaria species. Reference: (1) S. A. Alfieri, Jr. et al. Index of Plant Diseases in Florida (Revised). Fla. Dep. Agric. Consum. Serv. Div. Plant Ind. Bull. 11:389, 1984.

Download Full-text

First Report of Gray Mold of Strawberry Caused by Botrytis caroliniana in North Carolina

Plant Disease ◽

10.1094/pdis-12-11-1018-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 914-914 ◽

Cited By ~ 4

Author(s):

D. Fernández-Ortuño ◽

X. P. Li ◽

F. Wang ◽

G. Schnabel

Keyword(s):

North Carolina ◽

South Carolina ◽

New Species ◽

Aerial Mycelium ◽

Gray Mold ◽

Tween 20 ◽

Strawberry Fruit ◽

Single Spore ◽

First Report ◽

Control Fruit

Gray mold caused by Botrytis spp. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. In June 2011, strawberry fruit that was symptomatic of gray mold disease was collected from High Point county in North Carolina. Fruit had brown lesions that enlarged quickly and were covered with green-gray masses of spores followed by a soft rot. To isolate the causal agent, conidia were scraped off the fruit, suspended in 1% Tween 20, spread on water agar amended with 0.1% lactic acid, and emerging colonies were then transferred onto potato dextrose agar (PDA) medium. All but one single-spore colony (designated HP33) were at first colorless and later became gray to brown when the conidiphores and conidia developed on PDA. Isolate HP33 was white to pale gray with short, tufted aerial mycelium, black sclerotia in concentric rings, and did not produce conidia on PDA. Conidia were subhyaline to light brown, smooth, ellipsoid, ovoid or obovoid, and were on average 11.7 × 8.6 μm. The conidiophores were erect, septate, and brown to subhyaline from the base to apex, with swollen basal cell and multiple inflated conidiogenous cells. These morphological features were consistent with Botrytis caroliniana X. P. Li & G. Schnabel sp. nov., a new species isolated recently from blackberry fruit in South Carolina (2). All other single-spore isolates were confirmed to be B. cinerea as described previously (1). To confirm the identity of isolate HP33 to the species level, the necrosis and ethylene-inducing protein 1 (NEP1) was PCR amplified and sequenced by primer pairs NEP1for/NEP1rev as described previously (3). The nucleotide sequence matched the ones published for B. caroliniana (GenBank Accession Nos. JF811593, JF811594, and JF811595). Pathogenicity tests were conducted by inoculating 10 surface-sterilized strawberry fruit with single agar plugs (6 mm in diameter) containing actively growing mycelium; 10 control fruit received agar plugs without mycelium. The inoculated fruit were incubated for 3 days at room temperature in airtight plastic bags and after that developed typical gray mold symptoms. Koch's postulates were fulfilled by the reisolation of B. caroliniana from symptomatic fruit. Control fruit remained healthy. To our knowledge, this is the first report of B. caroliniana on strawberry. It is uncertain whether the new species requires management strategies different from those that control gray mold caused by B. cinerea. References: (1) D. Fernández-Ortuño et al. Plant Dis. 95:1482, 2011. (2) X. P. Li et al. Mycologia 2012, doi:10.3852/11-218. (3) M. Staats et al. Fungal Genet. Biol. 44:52, 2007.

Download Full-text