scholarly journals First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
J. E. Woodward ◽  
T. B. Brenneman ◽  
R. C. Kemerait ◽  
A. K. Culbreath ◽  
J. R. Clark
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Block Design ◽  
Gray Mold ◽  
American Phytopathological Society ◽  
Breeding Programs ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

scholarly journals Evaluation of Arachis Species for Resistance to Tomato Spotted Wilt Virus

2002 ◽  
Vol 29 (2) ◽  
pp. 79-84 ◽  
Author(s):  
J. H. Lyerly ◽  
H. T. Stalker ◽  
J. W. Moyer ◽  
K. Hoffman
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Insect Pests ◽  
Disease Incidence ◽  
Diploid Species ◽  
Breeding Programs ◽  
Arachis Species ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Cultivated Species ◽  
Wilt Virus

Abstract Tomato spotted wilt virus (TSWV) is an important plant pathogen with a wide host range, including the domesticated peanut (Arachis hypogaea L.). After initial outbreaks on peanut during the 1980s, the virus has spread to all peanut-producing states in the U.S. TSWV is transmitted by several species of thrips which are difficult to control with insecticides; therefore, control of TSWV most likely will come from selecting resistant genotypes in breeding programs. Although moderate levels of resistance have been discovered in A. hypogaea, complete virus resistance has not been found. Several Arachis species have desirable genes for plant resistances and tolerate many disease and insect pests better than the cultivated species. The objectives of this study were to (a) evaluate TSWV disease incidence and severity in accessions of Arachis species, and (b) compare levels of TSWV resistance in diploid species to selected A. hypogaea genotypes. In this study, 46 diploid Arachis spp. accessions were evaluated in the greenhouse by artificial inoculation tests for resistance to TSWV. Nine Arachis accessions were observed with no disease symptoms when TSWV isolate 10 was used as opposed to A. hypogaea lines that ranged from moderately to highly susceptible. Additional testing with more virulent isolates identified A. diogoi accession GKP 10602 and A. correntina accession GKP 9530 as highly resistant to the virus. These two accessions are being used as parents in crossing programs to incorporate TSWV resistance genes into A. hypogaea.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Tomato spotted wilt virus on Chrysanthemum in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 150-150 ◽  
Author(s):  
I. Stanković ◽  
A. Bulajić ◽  
A. Vučurović ◽  
D. Ristić ◽  
K. Milojević ◽  
...  
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Disease Incidence ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Maximum Parsimony Tree ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Negative Controls ◽  
Wilt Virus

In July 2011, greenhouse-grown chrysanthemum hybrid plants (Chrysanthemum × morifolium) with symptoms resembling those associated with tospoviruses were observed in the Kupusina locality (West Bačka District, Serbia). Disease incidence was estimated at 40%. Symptomatic plants with chlorotic ring spots and line patterns were sampled and tested by double antibody sandwich (DAS)-ELISA using polyclonal antisera (Bioreba AG, Reinach, Switzerland) against the two of the most devastating tospoviruses in the greenhouse floriculture industry: Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (2). Commercial positive and negative controls and extracts from healthy chrysanthemum tissue were included in each ELISA. TSWV was detected serologically in 16 of 20 chrysanthemum samples and all tested samples were negative for INSV. The virus was mechanically transmitted from ELISA-positive chrysanthemum samples to five plants each of both Petunia × hybrida and Nicotiana tabacum ‘Samsun’ using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite. Inoculated plants produced local necrotic spots and systemic chlorotic/necrotic concentric rings, consistent with symptoms caused by TSWV (1). The presence of TSWV in ELISA-positive chrysanthemum plants and N. tabacum‘Samsun’ was further confirmed by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using primers TSWVCP-f/TSWVCP-r specific to the nucleocapsid protein (N) gene (4). A Serbian isolate of TSWV from tobacco (GenBank Accession No. GQ373173) and RNA extracted from a healthy chrysanthemum plant were used as positive and negative controls, respectively. An amplicon of the correct predicted size (738-bp) was obtained from each of the plants assayed, and that derived from chrysanthemum isolate 529-11 was purified (QIAqick PCR Purification Kit, Qiagen) and sequenced (JQ692106). Sequence analysis of the partial N gene, conducted with MEGA5 software, revealed the highest nucleotide identity of 99.6% (99% amino acid identity) with 12 TSWV isolates deposited in GenBank originating from different hosts from Italy (HQ830186-87, DQ431237-38, DQ398945), Montenegro (GU355939-40, GU339506, GU339508), France (FR693055-56), and the Czech Republic (AJ296599). The consensus maximum parsimony tree obtained on a 705-bp partial N gene sequence of TSWV isolates available in GenBank revealed that Serbian TSWV isolate 529-11 from chrysanthemum was clustered in the European subpopulation 2, while the Serbian isolates from tomato (GU369723) and tobacco (GQ373172-73 and GQ355467) were clustered in the European subpopulation 1 denoted previously (3). The distribution of TSWV in commercial chrysanthemum crops is wide (2). To our knowledge, this is the first report of TSWV infecting chrysanthemum in Serbia. Since chrysanthemum popularity and returns have been rising rapidly, the presence of TSWV may significantly reduce quality of crops in Serbia. References: (1) Anonymous. OEPP/EPPO Bull. 34:271, 2004. (2) Daughtrey et al. Plant Dis. 81:1220, 1997. (3) I. Stanković et al. Acta Virol. 55:337, 2011. (4) A. Vučurović et al. Eur. J. Plant Pathol. 133:935, 2012.

Peanut plants in Queensland infected with tomato spotted wilt virus

1961 ◽  
Vol 12 (2) ◽  
pp. 239 ◽  
Author(s):  
K Helms ◽  
NE Grylls ◽  
GS Purss
Keyword(s):  
Arachis Hypogaea ◽  
Tomato Spotted Wilt Virus ◽  
Disease Incidence ◽  
Infective Virus ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Tagetes Minuta ◽  
New Hosts ◽  
The Mean ◽  
Wilt Virus

A disease of peanut (Arachis hypogaea L.) in Queensland, previously referred to as "chlorosis", was identified as being caused by the tomato spotted wilt virus. Symptoms of the disease on peanut are described. Erigeron bonariensis L., Tagetes minuta L., and Trifolium subterraneurn L. are recorded as new hosts. The disease was not seed-transmitted, although seeds developed lesions and were malformed. Infective virus was found in tissues of the integuments of immature seed. The maximum disease incidence recorded in an individual crop was 5.5%. The mean seed yield of diseased plants was 12.7 g per plant, whereas that of healthy plants was 128.2 g.

scholarly journals The First Report of Tomato spotted wilt virus on Gerbera and Chrysanthemun in Venezuela

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1161-1161 ◽  
Author(s):  
E. Marys ◽  
A. Mejías ◽  
E. Rodríguez-Román ◽  
D. Avilán ◽  
T. Hurtado ◽  
...  
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Disease Incidence ◽  
The United States ◽  
Cut Flowers ◽  
Rt Pcr ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Pcr Products ◽  
Ornamental Crops ◽  
Wilt Virus

Gerbera (Gerbera jamesonii) and Chrysanthemum (family Asteraceae) are two of the top 10 cut flowers of the world, with great commercial value. Since 1998, Venezuela began a floral industry to produce and export fresh cut gerbera and chrysanthemum, with 40% of nurseries concentrated in Altos Mirandinos (Miranda State, north central region of the country). For the past 2 years, greenhouse-grown gerbera and chrysanthemum have been observed displaying symptoms resembling those associated with tospoviruses. Symptomatic plants showed concentric rings, irregular chlorotic blotches, and deformation on leaves. Disease incidence was estimated at 30%. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical concentric ring symptoms on indicator plants Arachis hypogaea L. cv. San Martín, Capsicum chinense, and G. jamesonii 6 to 15 days after inoculation. In initial tests, leaves from each 30 symptomatic gerbera and chrysanthemum species from several greenhouse facilities in Altos Mirandinos reacted positively when tested by DAS-ELISA with polyclonal antisera (ATCC, Rockville, MD) raised against Tomato spotted wilt virus (TSWV). Total RNA was extracted with the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from two gerbera and two chrysanthemum ELISA-positive samples. The TSWV coat protein gene was amplified by conventional reverse transcription (RT)-PCR using primers CP1 TSWV (TTAACTTACAGCTGCTTT) and CP2 TSWV (CAAAGCATATAAGAACTT) (1). A single DNA product of ~823 bp was amplified from all samples. RT-PCR products were directly sequenced in both orientations and sequences were deposited in GenBank (Accession Nos. KF146700 and KF146701 derived from chrysanthemum, KF146702 and KF146703 derived from gerbera). The resulting sequences showed over 99% identity with each other. and were found to be closely related (over 99%) with TSWV isolates deposited in GenBank originating from different hosts from France (FR693058, FR693055), Montenegro (GU339506, GU339508, GU355940), Italy (HQ830187), New Zealand (KC494501), South Korea (KC261967), and the United States (AY744476). To our knowledge, this is the first confirmed report of TSWV infecting gerbera and chrysanthemum in Venezuela. The relatively widespread occurrence of TSWV in Miranda State underscores the need for systematic surveys to assess its incidence and impact on ornamental crops so that appropriate management tactics can be developed. Reference: (1) R. A. Mumford et al. J. Virol. Methods 57:109, 1996.

scholarly journals First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1481-1481
Author(s):  
F. P. Chen ◽  
X. L. Liu ◽  
X. P. Li ◽  
G. Schnabel
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Cross Resistance ◽  
Broad Host Range ◽  
Paper Strip ◽  
Single Spore ◽  
First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Transgressive Segregation and Long-Term Consistency for High TSWV Field Resistance in the ‘Georgia-06G’ Peanut Cultivar

2018 ◽  
Vol 19 (3) ◽  
pp. 201-206 ◽  
Author(s):  
W. D. Branch ◽  
A. K. Culbreath
Keyword(s):  
Disease Incidence ◽  
The United States ◽  
Transgressive Segregation ◽  
Field Resistance ◽  
Breeding Lines ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Production Area ◽  
Wilt Virus

Tomato spotted wilt disease caused by tomato spotted wilt virus (TSWV) is a major peanut (Arachis hypogaea L.) production problem in the United States. TSWV has become endemic since the mid-1980s in the southeastern U.S. peanut production area. ‘Georgia-06G’ is a large-seeded, TSWV-resistant, runner-type peanut cultivar, whereas ‘Georgia Greener’ is a sister line with a smaller seed size than Georgia-06G. Both Georgia-06G and Georgia Greener have greater TSWV general field resistance with higher yields, total sound mature kernels grade, and dollar values than the parents (‘Georgia Green’ and ‘C-99R’), which shows transgressive segregation for these desirable quantitative traits. Therefore, the objective of this 12-year study was to evaluate the higher TSWV host-plant resistance found in the Georgia-06G over time compared with many other runner- and virginia-type peanut cultivars and advanced breeding lines. Despite yearly variability in TSWV and total disease incidence, the data indicate that Georgia-06G exhibited long-term high TSWV and total disease field resistance at midseason and late season, respectively. Georgia-06G was also found to have among the highest pod yield and dollar value every year. The higher general TSWV field resistance of Georgia-06G appears to be consistent across many years and locations, similar to the moderate TSWV resistance in Georgia Green.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold of Pomegranate (Punica granatum) in Greece

Plant Disease ◽  
2009 ◽  
Vol 93 (12) ◽  
pp. 1346-1346 ◽  
Author(s):  
G. A. Bardas ◽  
G. D. Tzelepis ◽  
L. Lotos ◽  
G. S. Karaoglanidis
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Punica Granatum ◽  
The United States ◽  
Gray Mold ◽  
Fruit Rot ◽  
American Phytopathological Society ◽  
First Report ◽  
Surface Sterilization ◽  
Food Agric

Pomegranate is rapidly increasing in production in Greece. During August of 2008 in the region of Larisa (central Greece), preharvest fruit rot was observed on pomegranate (cv. Kapmaditika) that caused losses estimated at 10%. Symptoms first appeared as small spots on the fruits that later increased in size and developed into expanded, dark brown lesions. Internally, tissues were soft and brown with gray mycelia and conidiophores observed. Affected fruits decayed completely during 2 months of storage (5 to 6°C), causing yield losses of up to 20%. To isolate the casual agent, conidia and conidiophores were scraped aseptically from the internal tissues, suspended in sterile water, and streaked onto the surface of potato dextrose agar (PDA). Single hyphal tips were transferred to PDA, and the isolated fungus was identified as Botrytis cinerea Pers.:Fr. on the basis of morphological characteristics (2). B. cinerea was consistently isolated from symptomatic tissues. Colonies of B. cinerea on PDA were at first colorless and became gray to brown with the development of lemon-shaped conidia (average 7.5 × 9 μm). Sclerotia were black and varied in size (1.4 to 4.5 × 1.5 to 2.7 mm) and shape (2). Pathogenicity of the isolated fungus was tested by wound inoculating five mature pomegranate fruits (cv. Kampaditika) after surface sterilization with 5% sodium hypochlorite. Plugs of the fungus (5 mm in diameter) obtained from the colony margins were transferred onto a 3- × 3-mm wound on the surface of sterilized fruit. Sterile PDA plugs were used to inoculate five control pomegranate fruits. Fruit were incubated at 22°C and 80% relative humidity in the dark. Extensive decay, similar to that observed on diseased fruits in the field, was observed on inoculated fruits 7 days after inoculation, whereas control fruits showed no decay. The pathogen was reisolated from internal rotten tissues of inoculated fruit, but not from the noninoculated control fruits. Fruit rot of pomegranate caused by B. cinerea has been reported previously in the United States (1) and China (3). However, to our knowledge, this is the first report of B. cinerea causing gray mold of pomegranate in Greece. References: (1) A. M. French. California Plant Disease Host Index. Calif. Dept. Food Agric., Sacramento, 1989. (2) W. B. Hewitt. Compendium of Grape Diseases. American Phytopathological Society, 1994. (3) Z. Zhang. Flora Fungorum Sinicorum 26:277, 2006.

scholarly journals First Report of Fludioxonil Resistance in Botrytis cinerea from a Strawberry Field in Virginia

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 848-848 ◽  
Author(s):  
D. Fernández-Ortuño ◽  
P. K. Bryson ◽  
A. Grabke ◽  
G. Schnabel
Keyword(s):  
South Carolina ◽  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Crop Protection ◽  
Gray Mold ◽  
Resistant Isolate ◽  
Single Spore ◽  
First Report ◽  
Single Spore Isolate

Gray mold caused by Botrytis cinerea Pers.:Fr. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. Control of gray mold mainly depends on fungicides, including the phenylpyrrole fludioxonil, which is currently marketed in combination with cyprodinil as Switch 62.5WG (Syngenta Crop Protection, Research Triangle Park, Raleigh, NC). In 2012, 790 strains of B. cinerea were collected from 76 strawberry fields in eight states, including Arkansas, Florida, Georgia, Kansas, Maryland, North Carolina, South Carolina, and Virginia. Strains were collected from sporulating flowers and fruit and sensitivity to fludioxonil was determined using a conidial germination assay as previously described (2). Only one isolate from a farm located in Westmoreland County, Virginia, grew on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and was therefore considered low resistant. The isolate did not grow on 10 μg/ml. All other 789 isolates did not grow at either of the two doses. This assay was repeated twice with a single-spore culture of the same strain. In both cases, residual growth was observed on the fludioxonil-amended medium of 0.1 μg/ml. The single spore isolate was confirmed to be B. cinerea Pers. using cultural and molecular tools as described previously (1). To assess resistance in vivo, commercially grown ripe strawberry fruit were rinsed with sterile water, dried, placed into plastic boxes (eight strawberries per box for each of the three replicates per treatment), and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of fludioxonil (Scholar SC, Syngenta) to runoff using a hand mister. This dose reflects the rate recommended for gray mold control according to the Scholar label. Each fruit was stabbed at three equidistant points, each about 1 cm apart and 1 cm deep using a syringe tip. Wounds were injected with a 30-μl droplet of conidia suspension (106 spores/ml) of either 5 sensitive or the resistant isolate. Control fruit were inoculated with water. After inoculation, the fruit were kept at 22°C for 4 days. In two independent experiments, sensitive and low resistant isolates were indistinguishable in pathogenicity on detached, unsprayed fruit. The low resistant isolate developed gray mold disease on all treated and untreated fruit (100% disease incidence) as determined by the absence or presence of gray mold symptoms. The sensitive isolates only developed disease on untreated fruit. The EC50 values, determined in microtiter assays with concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μg/ml fludioxonil, were 0.01 μg/ml for the sensitive isolates and 0.26 μg/ml for the resistant isolate. To our knowledge, this is the first report of fludioxonil resistance in B. cinerea from strawberry in North America. Our monitoring results indicate that resistance is emerging 10 years after the introduction of fludioxonil and stress the importance of chemical rotation for gray mold control. References: (1) X. P. Li et al. Plant Dis. 96:1634, 2012. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

scholarly journals Incidence of Tomato spotted wilt virus (Bunyaviridae) and Tobacco Thrips in Virginia-Type Peanuts in North Carolina

Plant Disease ◽  
2000 ◽  
Vol 84 (4) ◽  
pp. 459-464 ◽  
Author(s):  
L. E. Garcia ◽  
R. L. Brandenburg ◽  
J. E. Bailey
Keyword(s):  
North Carolina ◽  
Tomato Spotted Wilt Virus ◽  
Disease Incidence ◽  
Block Design ◽  
Virus Titer ◽  
Field Trials ◽  
Preliminary Evaluation ◽  
Tomato Spotted Wilt ◽  
Tobacco Thrips ◽  
Wilt Virus

Virginia-type peanut (Arachis hypogaea) cultivars were monitored for incidence of Tomato spotted wilt virus (TSWV) and abundance of Frankliniella fusca, the tobacco thrips, in North Carolina during 1995 and 1996. A preliminary evaluation of 225 peanut genotypes for TSWV-resistant or -tolerant genotypes was conducted in 1995. The incidence of TSWV in cultivar NC-9 was twice that of cultivar NC-V11. In 1996, field trials designed to evaluate TSWV susceptibility were conducted with three widely grown commercial peanut cultivars in North Carolina. They were NC-9, NC-V11, and NC-12C, a newly released cultivar. A randomized complete block design was utilized at three locations. Disease incidence was evaluated weekly from 2 weeks postplanting until 2 weeks prior to harvest. Mechanical inoculation of the three cultivars resulted in no difference in relative leaf virus titer as determined from optical density readings following DAS-ELISA for 4 successive weeks beginning at 13 days postinoculation. NC-9 ranked highest in incidence of disease (7%), followed by NC-12C (6%) and NC-V11 (5%). Thrips counts were greatest on NC-V11, followed by NC-9 and NC-12C. Disease incidence overall was 5.96%, but ranged from 3.08 to 11.15% among the three sites. Yield was affected by the temporal occurrence of symptoms beginning at the fifth week postplanting. Greatest yield losses occurred in those plants with the earliest visible foliar symptoms.

Sign in / Sign up

Export Citation Format

Share Document