First Report of Root and Crown Rot of Almond Caused by Phytophthora spp. in Turkey

Almond (Prunus dulcis) production is currently increasing in Turkey. Losses of approximately 1% associated with root and crown rot of almond seedlings were observed in two commercial nurseries in Ankara and Düzce provinces in 2009. Aboveground symptoms were leaf chlorosis and wilt. Feeder roots were decayed, necrosis occurred on taproots and basal stems, and plants collapsed within several weeks. Roots were washed in tap water and 9 to 10 pieces (3 to 5 mm long) of root tissue taken from the margins of canker lesions, without surface disinfection, were placed on selective medium P5ARPH-CMA (2). Plates were incubated for 3 to 5 days at 20°C in darkness and a number of Phytophthora spp. were recovered. Actively growing mycelium was transferred to carrot piece agar containing β-sitosterol (per liter: carrot piece, 40 g; agar, 20 g; β-sitosterol, 20 mg). Isolates were identified as Phytophthora cactorum and P. citrophthora on the basis of morphological characteristics (1). P. cactorum produced abundant sporangia, oogonia, and paragynous antheridia on carrot piece agar plus β-sitosterol. It had conspicuously papillate and caducous sporangia with short pedicel. Sporangia were usually ovoid but sometimes nearly spherical. P. citrophthora did not produce sexual structures in single culture. It produced papillate, noncaducous sporangia, which were usually ovoid and obpyriform, often asymmetrically shaped and rarely possessed more than one apex. P. citrophthora did not grow at 35°C but it grew well at 30°C. Isolate identities were confirmed by sequence analysis of the ribosomal DNA internal transcribed spacers 1 and 2 (GenBank Accession Nos. HM357622, HM357623, HM357624, HM357625) using primers ITS1 and ITS2 (3). One representative isolate of each species was used to inoculate eight 2-year-old almond plants with an agar plug with actively growing mycelium that was attached to exposed cambium of basal stems. Agar plugs without mycelium were used for eight control plants. All plants inoculated with Phytophthora spp. collapsed within 3 to 4 weeks. Control plants remained healthy. Phytophthora spp. were reisolated from necrotic basal stems. To our knowledge, this is the first report of P. cactorum and P. citrophthora of almond in Turkey. References: (1) M. E. Gallegly and C. Hong. Phytophthora, Identifying Species by Morphology and DNA Fingerprints. The American Phytopathological Society, St. Paul, MN, 2008. (2) S. N. Jeffers and S. B. Martin. Plant Dis. 70:1038, 1986. (3) S. G. Roy et al. J. Phytopathol. 157:666, 2009.

Download Full-text

First report of Fusarium commune causing root and crown rot on maize in Italy

Plant Disease ◽

10.1094/pdis-01-21-0075-pdn ◽

2021 ◽

Author(s):

Monica Mezzalama ◽

Vladimiro Guarnaccia ◽

Ilaria Martino ◽

Giulia Tabome ◽

Maria Lodovica GULLINO

Keyword(s):

Plant Disease ◽

Tap Water ◽

Morphological Characteristics ◽

Plant Diseases ◽

Crown Rot ◽

Conidial Suspension ◽

Fusarium Spp ◽

First Report ◽

Root And Crown Rot ◽

Pathogenicity Tests

Maize (Zea mays L.) is a cereal crop of great economic importance in Italy; production is currently of 62,587,469 t, with an area that covers 628,801 ha, concentrated in northern Italy (ISTAT 2020). Fusarium species are associated with root and crown rot causing failures in crop establishment under high soil moisture. In 2019 maize seedlings collected in a farm located in San Zenone degli Ezzelini (VI, Italy) showed root and crown rot symptoms with browning of the stem tissues, wilting of the seedling, and collapsing due to the rotting tissues at the base of the stem. The incidence of diseased plants was approximately 15%. Seedlings were cleaned thoroughly from soil residues under tap water. Portions (about 3-5 mm) of tissue from roots and crowns of the diseased plants were cut and surface disinfected with a water solution of NaClO at 0.5% for 2 minutes and rinsed in sterile H20. The tissue fragments were plated on Potato Dextrose Agar (PDA) amended with 50 mg/l of streptomycin sulfate and incubated for 48-72 hours at 25oC. Over the 80 tissue fragments plated, 5% were identified as Fusarium verticillioides, 60% as Fusarium spp., 35% developed saprophytes. Fusarium spp. isolates that showed morphological characteristics not belonging to known pathogenic species on maize were selected and used for further investigation while species belonging to F. oxysporum were discarded. Single conidia of the Fusarium spp. colonies were cultured on PDA and Carnation Leaf Agar (CLA) for pathogenicity tests, morphological and molecular identification. The colonies showed white to pink, abundant, densely floccose to fluffy aerial mycelium. Colony reverse showed light violet pigmentation, in rings on PDA. On CLA the isolates produced slightly curved macronidia with 3 septa 28.1 - 65.5 µm long and 2.8-6.3 µm wide (n=50). Microconidia were cylindrical, aseptate, 4.5 -14.0 µm long and 1.5-3.9 µm wide (n=50). Spherical clamydospores were 8.8 ± 2.5 µm size (n=30), produced singly or in pairs on the mycelium, according to the description by Skovgaard et al. (2003) for F. commune. The identity of two single-conidia strains was confirmed by sequence comparison of the translation elongation factor-1α (tef-1α), and RNA polymerase II subunit (rpb2) gene fragments (O’Donnell et al. 2010). BLASTn searches of GenBank, and Fusarium-ID database, using the partial tef-1α (MW419921, MW419922) and rpb2 (MW419923, MW419924) sequences of representative isolate DB19lug07 and DB19lug20, revealed 99% identity for tef-1α and 100% identity to F. commune NRRL 28387(AF246832, AF250560). Pathogenicity tests were carried out by suspending conidia from a 10-days old culture on PDA in sterile H2O to 5×104 CFU/ml. Fifty seeds were immersed in 50 ml of the conidial suspension of each isolate for 24 hours and in sterile water (Koch et al. 2020). The seeds were drained, dried at room temperature, and sown in trays filled with a steamed mix of white peat and perlite, 80:20 v/v, and maintained at 25°C and RH of 80-85% for 14 days with 12 hours photoperiod. Seedlings were extracted from the substrate, washed under tap water, and observed for the presence of root and crown rots like the symptoms observed on the seedlings collected in the field. Control seedlings were healthy and F. commune was reisolated from the symptomatic ones and identified by resequencing of tef-1α gene. F. commune has been already reported on maize (Xi et al. 2019) and other plant species, like soybean (Ellis et al. 2013), sugarcane (Wang et al. 2018), potato (Osawa et al. 2020), indicating that some attention must be paid in crop rotation and residue management strategies. To our knowledge this is the first report of F. commune as a pathogen of maize in Italy. References Ellis M L et al. 2013. Plant Disease, 97, doi: 10.1094/PDIS-07-12-0644-PDN. ISTAT. 2020. http://dati.istat.it/Index.aspx?QueryId=33702. Accessed December 28, 2020. Koch, E. et al. 2020. Journal of Plant Diseases and Protection. 127, 883–893 doi: 10.1007/s41348-020-00350-w O’Donnell K et al. 2010. J. Clin. Microbiol. 48:3708. https://doi.org/10.1128/JCM.00989-10 Osawa H et al. 2020. Journal of General Plant Pathology, doi.org/10.1007/s10327-020-00969-5. Skovgaard K 2003. Mycologia, 95:4, 630-636, DOI: 10.1080/15572536.2004.11833067. Wang J et al. 2018. Plant Disease, 102, doi/10.1094/PDIS-07-17-1011-PDN Xi K et al. 2019. Plant Disease, 103, doi/10.1094/PDIS-09-18-1674-PDN

Download Full-text

First Report of Phytophthora chlamydospora Causing Root and Crown Rot on Almond (Prunus dulcis) Trees in Turkey

Plant Disease ◽

10.1094/pdis-02-16-0155-pdn ◽

2016 ◽

Vol 100 (8) ◽

pp. 1796-1796 ◽

Cited By ~ 4

Author(s):

Ş. Türkölmez ◽

S. Derviş ◽

O. Çiftçi ◽

Ç. Ulubaş Serçe

Keyword(s):

Prunus Dulcis ◽

Crown Rot ◽

First Report ◽

Root And Crown Rot

Download Full-text

First Report of Rhizoctonia solani AG 4 on Lamb's Lettuce in Italy

Plant Disease ◽

10.1094/pd-90-1109c ◽

2006 ◽

Vol 90 (8) ◽

pp. 1109-1109 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Northern Italy ◽

Crown Rot ◽

Pathogenicity Test ◽

First Report ◽

Pathogenicity Tests ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Extensive Necrosis

Lamb's lettuce or corn salad (Valerianella olitoria) is increasingly grown in Italy and used primarily in the preparation of mixed processed salad. In the fall of 2005, plants of lamb's lettuce, cv Trophy, exhibiting a basal rot were observed in some commercial greenhouses near Bergamo in northern Italy. The crown of diseased plants showed extensive necrosis, progressing to the basal leaves, with plants eventually dying. The first symptoms, consisting of water-soaked zonate lesions on basal leaves, were observed on 30-day-old plants during the month of October when temperatures ranged between 15 and 22°C. Disease was uniformly distributed in the greenhouses, progressed rapidly in circles, and 50% of the plants were affected. Diseased tissue was disinfested for 1 min in 1% NaOCl and plated on potato dextrose agar amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily isolated and maintained in pure culture after single-hyphal tipping (3). The five isolates of R. solani, obtained from affected plants successfully anastomosed with tester isolate AG 4, no. RT 31, received from R. Nicoletti of the Istituto Sperimentale per il Tabacco, Scafati, Italy (2). The hyphal diameter at the point of anastomosis was reduced, and cell death of adjacent cells occurred (1). Pairings were also made with AG 1, 2, 3, 5, 7, and 11 with no anastomoses observed between the five isolates and testers. For pathogenicity tests, the inoculum of R. solani (no. Rh. Vale 1) was grown on autoclaved wheat kernels at 25°C for 10 days. Plants of cv. Trophy were grown in 10-liter containers (20 × 50 cm, 15 plants per container) on a steam disinfested substrate (equal volume of peat and sand). Inoculations were made on 20-day-old plants by placing 2 g of infected wheat kernels at each corner of the container with 3 cm as the distance to the nearest plant. Plants inoculated with clean wheat kernels served as controls. Three replicates (containers) were used. Plants were maintained at 25°C in a growth chamber programmed for 12 h of irradiation at a relative humidity of 80%. The first symptoms, consisting of water-soaked lesions on the basal leaves, developed 5 days after inoculation with crown rot and plant kill in 2 weeks. Control plants remained healthy. R. solani was consistently reisolated from infected plants. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of R. solani on lamb's lettuce in Italy as well as worldwide. The isolates were deposited at the AGROINNOVA fungal collection. The disease continues to spread in other greenhouses in northern Italy. References: (1) D. Carling. Rhizoctonia Species: Pages 37–47 in: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh et al., eds. Kluwer Academic Publishers, the Netherlands, 1996. (2) J. Parmeter et al. Phytopathology, 59:1270, 1969. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1996.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Neopestalotiopsis clavispora Causing Root and Crown Rot on Strawberry in Italy

Plant Disease ◽

10.1094/pdis-03-19-0673-pdn ◽

2019 ◽

Vol 103 (11) ◽

pp. 2959-2959 ◽

Cited By ~ 1

Author(s):

G. Gilardi ◽

F. Bergeretti ◽

M. L. Gullino ◽

A. Garibaldi

Keyword(s):

Crown Rot ◽

First Report ◽

Root And Crown Rot

Download Full-text

First Report of Phytophthora ramorum on Viburnum bodnantense in Belgium

Plant Disease ◽

10.1094/pdis.2003.87.2.203c ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203 ◽

Cited By ~ 11

Author(s):

D. De Merlier ◽

A. Chandelier ◽

M. Cavelier

Keyword(s):

The Netherlands ◽

Plant Protection ◽

Morphological Characteristics ◽

Pcr Primers ◽

Selective Medium ◽

Phytophthora Species ◽

Phytophthora Ramorum ◽

Pathogenicity Test ◽

First Report ◽

Root Necrosis

In the past decade, a new Phytophthora species inducing shoot canker on Rhododendron and dieback of Viburnum has been observed in Europe, mainly in Germany and the Netherlands, and California. This new pathogen has been named Phytophthora ramorum (3). In May 2002, a diseased Viburnum plant (Viburnum bodnantense) from the Plant Protection Service (Ministry of Agriculture, Belgium) was submitted to our laboratory for diagnosis. Symptoms included wilting, leaves turning from green to brown, discolored vascular tissues, and root necrosis. The plant came from a Belgian ornamental nursery that obtained supplies of stock plants from the Netherlands. Pieces of necrotic root tissue were excised, surface-disinfected, and transferred aseptically to a Phytophthora selective medium. P. ramorum was identified based on morphological characteristics, including the production of numerous, thin-walled chlamydospores (25 to 70 µm in diameter, average 43 µm) and deciduous, semi-papillate sporangia arranged in clusters. Radial growth after 6 days at 20°C on V8 juice agar was 2.8 mm per day. Random amplified microsatellite markers (RAMS) (2) from the total genomic DNA of the Belgian strain (CBS 110901) were similar to those of P. ramorum reference strains (CBS 101330, CBS 101332, and CBS 101554). Using PCR primers specific for P. ramorum, the identification was confirmed by W. A. Man in't Veld (Plantenziektenkundige Dienst, Wageningen, the Netherlands) (1). A pathogenicity test was carried out on three sterile cuttings of Rhododendron catawbiense (3). Brown lesions were observed on the inoculated cuttings after 6 to 7 days. None of the three uninoculated cuttings showed symptoms of infection. P. ramorum was reisolated from lesion margins on the inoculated cuttings. To our knowledge, this is the first report of the fungus from Belgium. Since our initial observation, we have found P. ramorum in other Belgian nurseries on R. yakusimanum. References: (1) M. Garbelotto et al. US For. Ser. Gen. Tech. Rep. PSW-GRT. 184:765, 2002. (2) J. Hantula et al. Mycol. Res. 101:565, 1997. (3) S. Werres et al. Mycol. Res. 105:1155, 2001.

Download Full-text

First Report of Phytophthora hydropathica Causing Wilting and Shoot Dieback on Viburnum in Italy

Plant Disease ◽

10.1094/pdis-03-14-0308-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1582-1582 ◽

Cited By ~ 5

Author(s):

S. Vitale ◽

L. Luongo ◽

M. Galli ◽

A. Belisario

Keyword(s):

Natural Infection ◽

Morphological Characteristics ◽

Leaf Tissue ◽

The United States ◽

Selective Medium ◽

Phytophthora Species ◽

Phytophthora Ramorum ◽

Width Ratio ◽

Morphological Identification ◽

First Report

The genus Viburnum comprises over 150 species of shrubs and small trees such as Laurustinus (Viburnum tinus L.), which is one of the most widely used ornamental plants in private and public gardens. Furthermore, it commonly forms stands of natural woodland in the Mediterranean area. In autumn 2012, a survey was conducted to determine the presence of Phytophthora ramorum on Viburnum in commercial nurseries in the Latium region where wilting, dieback, and death of twigs were observed on 30% of the Laurustinus plants. A Phytophthora species was consistently recovered from soil rich in feeder roots from potted Laurustinus plants showing symptoms. Soil samples were baited with rhododendron leaves. Small pieces of leaf tissue cut from the margin of lesions were plated on P5ARPH selective medium (4). Pure cultures, obtained by single-hypha transfers on potato dextrose agar (PDA), were petaloid. Sporangia formation was induced on pepper seeds (3). Sporangia were almost spherical, ovoid or obpyriform, non-papillate and non-caducous, measuring 36.6 to 71.4 × 33.4 to 48.3 μm (average 53.3 × 37.4 μm) with a length/width ratio of 1.4. Chlamydospores were terminal and 25.2 to 37.9 μm in diameter. Isolates were considered heterothallic because they did not produce gametangia in culture or on the host. All isolates examined had 30 to 35°C as optimum temperatures. Based on these morphological characteristics, the isolates were identified as Phytophthora hydropathica (2). Morphological identification was confirmed by internal transcribed spacer (ITS), and mitochondrial partial cytochrome oxidase subunit 2 (CoxII) with BLAST analysis in the NCBI database revealing 99% identity with ITS and 100% identity with CoxII. The sequences of the three isolates AB234, AB235, and AB236 were deposited in European Nucleotide Archive (ENA) with the accession nos. HG934148, HG934149, and HG934150 for ITS and HG934151, HG934152, and HG934153 for CoxII, respectively. Pathogenicity tests were conducted in the greenhouse on a total of six 1-year-old shoots cut from V. tinus plants with two inoculation points each. Mycelial plugs cut from the margins of actively growing 8-day-old cultures on PDA were inserted through the epidermis into the phloem. Controls were treated as described above except that sterile PDA plugs replaced the inoculum. Shoots were incubated in test tubes with sterile water in the dark at 24 ± 2°C. After 2 weeks, lesions were evident at the inoculation points and symptoms were similar to those caused by natural infection. P. hydropathica was consistently re-isolated from the margin of lesions, while controls remained symptomless. In the United States in 2008, P. hydropathica was described as spreading from irrigation water to Rhododendron catawbiense and Kalmia latifolia (2). This pathogen can also attack several other horticultural crops (1), but to our knowledge, this is the first report of P. hydropathica causing wilting and shoot dieback on V. tinus. References: (1) C. X. Hong et al. Plant Dis. 92:1201, 2008. (2) C. X. Hong et al. Plant Pathol. 59:913, 2010. (3) E. Ilieva et al. Eur. J. Plant Path. 101:623, 1995. (4) S. N. Jeffers and S. B. Martin. Plant Dis. 70:1038, 1986.

Download Full-text

First Report of Clubroot on Capsella bursa-pastoris Caused by Plasmodiophora brassicae in Sichuan Province of China

Plant Disease ◽

10.1094/pdis-04-13-0395-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 687-687 ◽

Cited By ~ 2

Author(s):

L. Ren ◽

X. P. Fang ◽

C. C. Sun ◽

K. R. Chen ◽

F. Liu ◽

...

Keyword(s):

Plasmodiophora Brassicae ◽

Tap Water ◽

Disease Incidence ◽

Morphological Characteristics ◽

Pcr Amplification ◽

Sichuan Province ◽

Clubroot Disease ◽

Cruciferous Vegetable ◽

First Report ◽

Resting Spores

Shepherd's purse (Capsella bursa-pastoris (L.) Medicus) is an edible and wild medicinal plant widely distributed in China. This plant has been cultivated in Shanghai, China, since the end of the 19th century. Infection of C. bursa-pastoris by Plasmodiophora brassicae, the causal agent of clubroot disease on Brassica spp. has been reported in Korea (2), but is not known to occur in China. In February of 2011, stunted and wilted shepherd's purse (SP) plants were observed in a field planted to oilseed rapes (B. napus) in Sichuan Province of China. Symptomatic SP plants also exhibited root galls. Disease incidence was 6.2% and 100% for SP and B. napus, respectively. Root galls on diseased SP plants were collected for pathogen identification. Many resting spores were observed when the root galls were examined under a light microscope. The resting spores were circular in shape, measuring 2.0 to 3.1 μm in diameter (average 2.6 μm). PCR amplification was conducted to confirm the pathogen. DNA was extracted from root galls and healthy roots (control) of SP. Two primers, TC2F (5′-AAACAACGAGTCAGCTTGAATGCTAGTGTG-3′) and TC2R (5′-CTTTAGTTGTGTTTCGGCTAGGATGGTTCG-3′) were used to detect P. brassicae (1). No PCR amplifications were observed with the control DNA as template. A fragment of the expected size (approximately 520 bp) was obtained when DNA was amplified from diseased roots of SP. These results suggest that the pathogen in the galled roots of SP is P. brassicae. Pathogenicity of P. brassicae in SP was tested on plants of both SP and Chinese cabbage (CC) (B. campestris ssp. pekinensis). A resting spore suspension prepared from naturally infected SP roots was mixed with a sterilized soil in two plastic pots, resulting in a final concentration of 5 × 106 spores/g soil. Soil treated with the same volume of sterile water was used as a control. Seeds of SP and CC were pre-germinated on moist filter paper for 2 days (20°C) and seeded into the infested and control pots, one seed per pot for planted for CC and four seeds per pot for SP. The pots were placed in a chamber at 15 to 25°C under 12 h light and 12 h dark. Plants in each pot were uprooted after 4 weeks and the roots of each plant were washed under tap water and rated for clubroot disease. No disease symptoms were observed in the control treatments of SP or CC. Plants of both species showed symptoms of clubroot, with the disease incidence of 62.5% and 100% on SP and CC, respectively. The pathogen was isolated from diseased roots of each plant and confirmed as P. brassicae based on morphological characteristics and PCR detection. To our knowledge, this is the first report of clubroot disease on C. bursa-pastoris in Sichuan Province of China. This finding suggests that it may be necessary to manage C. bursa-pastoris in cruciferous vegetable (cabbage, turnip) and oilseed rape production fields. References: (1) T. Cao et al. Plant Dis. 91:80, 2007. (2) W. G. Kim et al. Microbiology 39:233, 2011.

Download Full-text

First Report of Phytophthora citrophthora on Penstemon barbatus in Italy

Plant Disease ◽

10.1094/pd-90-1260a ◽

2006 ◽

Vol 90 (9) ◽

pp. 1260-1260 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

D. Minerdi ◽

M. L. Gullino

Keyword(s):

Its Region ◽

The United States ◽

Phytophthora Species ◽

Crown Rot ◽

Pathogenicity Test ◽

Phytophthora Citrophthora ◽

First Report ◽

Blastn Analysis ◽

Root And Crown Rot ◽

Pathogenicity Tests

Penstemon barbatus (Cav.) Roth (synonym Chelone barbata), used in parks and gardens and sometimes grown in pots, is a plant belonging to the Scrophulariaceae family. During the summers of 2004 and 2005, symptoms of a root rot were observed in some private gardens located in Biella Province (northern Italy). The first symptoms resulted in stunting, leaf discoloration followed by wilt, root and crown rot, and eventually, plant death. The diseased tissue was disinfested for 1 min in 1% NaOCl and plated on a semiselective medium for Oomycetes (4). The microorganism consistently isolated from infected tissues, grown on V8 agar at 22°C, produced hyphae with a diameter ranging from 4.7 to 5.2 μm. Sporangia were papillate, hyaline, measuring 43.3 to 54.4 × 26.7 to 27.7 μm (average 47.8 × 27.4 μm). The papilla measured from 8.8 to 10.9 μm. These characteristics were indicative of a Phytophthora species. The ITS region (internal transcribed spacer) of rDNA was amplified using primers ITS4/ITS6 (3) and sequenced. BLASTn analysis (1) of the 800 bp obtained showed a 100% homology with Phytophthora citrophthora (R. & E. Sm.) Leonian. The nucleotide sequence has been assigned GenBank Accession No. DQ384611. For pathogenicity tests, the inoculum of P. citrophthora was prepared by growing the pathogen on autoclaved wheat and hemp kernels (2:1) at 25°C for 20 days. Healthy plants of P. barbatus cv. Nano Rondo, 6 months old, were grown in 3-liter pots (one plant per pot) using a steam disinfested substrate (peat/pomix/pine bark/clay 5:2:2:1) in which 200 g of kernels per liter of substrate were mixed. Noninoculated plants served as control treatments. Three replicates were used. Plants were maintained at 15 to 20°C in a glasshouse. The first symptoms, similar to those observed in the gardens, developed 21 days after inoculation, and P. citrophthora was consistently reisolated from infected plants. Noninoculated plants remained healthy. The pathogenicity test was carried out twice with similar results. A nonspecified root and crown rot of Penstemon spp. has been reported in the United States. (2). To our knowledge, this is the first report of P. citrophthora on P. barbatus in Italy as well as in Europe. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997 (2) F. E. Brooks and D. M. Ferrin. Plant Dis. 79:212, 1995. (3) D. E. L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (4) H. Masago et al. Phytopathology 67:425, 1977.

Download Full-text

Pumpkin Fruit Rot in North Carolina Caused by Phytophthora nicotianae

Plant Disease ◽

10.1094/pdis.2000.84.8.923a ◽

2000 ◽

Vol 84 (8) ◽

pp. 923-923

Author(s):

G. J. Holmes

Keyword(s):

Fungal Growth ◽

Average Diameter ◽

Soft Rot ◽

Selective Medium ◽

Phytophthora Nicotianae ◽

Crown Rot ◽

Fruit Rot ◽

Unknown Etiology ◽

Postharvest Diseases ◽

Phytophthora Spp

In 1999, during an evaluation of pumpkin (Cucurbita pepo) fruit for susceptibility to naturally occurring postharvest diseases, a soft rot of unknown etiology was noted. No fungal growth or sporulation was seen on the fruit surface and no root or crown rot was observed in the field. When fruit were cross-sectioned, masses of white, floccose mycelium covering large sections of the seed cavity were observed. Rot was observed in 21 fruit (6.4% of the total). The fungus was isolated from symptomatic fruit on a modified P10ARPH agar medium, semi-selective for Phytophthora spp. (2). Isolates from eight fruit formed papillate, ovoid sporangia, abundant chlamydospores, and colonies characteristic of P. nicotianae (1). No oospores were produced. Four sound pumpkin fruit (cv. Early Autumn) were inoculated with four isolates (one isolate per fruit). Each isolate was recovered from a different fruit. Pumpkins were surface sterilized at the point of inoculation by wetting with 70% ethanol. Inoculation was done by removing a small amount of mycelium from pure culture using a sterile, wooden toothpick and inserting it 2 cm deep into opposite sides of the mid section of sound fruit (two inoculations per fruit). Control fruit were punctured with sterile toothpicks (once per fruit). First symptoms appeared 4 days after inoculation at room temperature (22 to 24°C). Symptoms consisted of circular, water-soaked areas originating from the point of inoculation. Average diameter (based on four measurements on two fruit) of the water-soaked lesions were 3 cm at first appearance (i.e., 4 days) and 11 cm 10 days after inoculation. No symptoms developed on controls. When symptomatic fruit were cross-sectioned, masses of white, floccose mycelium were noted. Reisolation of this mycelium onto selective medium yielded P. nicotianae, thus fulfilling Koch's postulates. This is the first report of P. nicotianae causing fruit rot of pumpkins. References: (1) D. C. Erwin and O. K. Ribeiro. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN. (2) H. D. Shew. Phytopathology 77:1090, 1987.

Download Full-text