scholarly journals First report of Grapevine enamovirus 1 in Vitis vinifera cultivar ‘Meunier’ in France.

Plant Disease ◽  
2021 ◽  
Author(s):  
Jean-Michel Hily ◽  
Veronique Komar ◽  
Guillaume Mathieu ◽  
Pierre Mustin ◽  
Anne-Sophie Spilmont ◽  
...  
Keyword(s):  
Taqman Assay ◽  
Coding Region ◽  
Rt Pcr ◽  
Grapevine Fanleaf Virus ◽  
Reading Frame ◽  
Grapevine Pinot Gris Virus ◽  
Geographic Regions ◽  
Rupestris Stem Pitting ◽  
Stem Pitting ◽  
Overlapping Region

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera ‘Meunier’ leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5’ untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3’-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected ‘Meunier’ grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the ‘Meunier’ grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5’ untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3’-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected ‘Meunier’ grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the ‘aphid transmission protein’ producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was found positive for GEV-1 in gapevine in France.

scholarly journals Incidência de vírus em videiras no Nordeste brasileiro e caracterização molecular parcial de isolados virais locais

2015 ◽  
Vol 45 (3) ◽  
pp. 379-385 ◽  
Author(s):  
Aricléia de Moraes Catarino ◽  
Thor Vinícius Martins Fajardo ◽  
Gilvan Pio-Ribeiro ◽  
Marcelo Eiras ◽  
Osmar Nickel
Keyword(s):  
Grapevine Virus ◽  
Rt Pcr ◽  
Grapevine Fanleaf Virus ◽  
Grapevine Virus A ◽  
Grapevine Virus B ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

Os objetivos deste trabalho foram identificar as espécies virais presentes em vinhedos comerciais de duas regiões do Nordeste do Brasil e realizar a caracterização molecular parcial de isolados de três espécies virais. A diagnose foi realizada por meio de RT-PCR em tempo real para a detecção de Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine leafroll-associated virus 2, 3 e 4 (GLRaV-2, -3 e -4), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV) e Grapevine fanleaf virus (GFLV). Exceto para GFLV, os vírus avaliados estão amplamente disseminados nas áreas amostradas, frequentemente em altas incidências e em infecções múltiplas, de até 98% e 76,4%, na Zona da Mata e no Vale do São Francisco, respectivamente. Isolados locais de GVA, GVB e GLRaV-3 foram parcialmente caracterizados com base na sequência completa de nucleotídeos do gene da proteína capsidial e apresentaram alta porcentagem de identidade de nucleotídeos com outros isolados brasileiros: 91,2% (GVA), 99,8% (GVB) e 99,7% (GLRaV-3)

scholarly journals Detecção e identificação molecular de vírus associados a videiras sintomáticas e assintomáticas

2010 ◽  
Vol 40 (11) ◽  
pp. 2249-2255 ◽  
Author(s):  
Marcos Fernando Basso ◽  
Thor Vinícius Martins Fajardo ◽  
Marcelo Eiras ◽  
Ricardo Antônio Ayub ◽  
Osmar Nickel
Keyword(s):  
Mosaic Virus ◽  
Grapevine Virus ◽  
Rt Pcr ◽  
Grapevine Fanleaf Virus ◽  
Arabis Mosaic Virus ◽  
Grapevine Virus A ◽  
Grapevine Virus B ◽  
Para Determinar ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

A propagação vegetativa da videira favorece infecções virais múltiplas, com expressão diferencial de sintomas em função da combinação da cultivar ou espécie da hospedeira com a espécie viral. Os objetivos deste trabalho foram detectar e identificar as espécies virais presentes em duas espécies/cultivares de videira: uma sintomática e outra assintomática. DsRNA de ambas as amostras foi submetido à RT-PCR com 17 pares de oligonucleotídeos específicos para a detecção de Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Rupestris stem pitting-associated virus (RSPaV), Grapevine leafroll-associated virus 1 a 4 (GLRaV-1 a -4), além de três pares de oligonucleotídeos degenerados. Pelo menos um fragmento amplificado, por par de oligonucleotídeos, foi clonado e sequenciado. Plantas sintomáticas e assintomáticas mostraram infecções múltiplas por RSPaV, GLRaV-2 e/ou GLRaV-3. As sequências de nucleotídeos obtidas para sete isolados de RSPaV, três de GLRaV-2 e dois de GLRaV-3 apresentaram identidades superiores a 90% com espécies homólogas e permitiram a definição das possíveis estirpes presentes nas amostras infectadas. Esses resultados evidenciam a necessidade da diagnose viral baseada em testes específicos para determinar a condição sanitária da videira.

scholarly journals Detecção e caracterização biológica e molecular de Rupestris stem-pitting associated virus e seu efeito na fotossíntese de videiras

2004 ◽  
Vol 29 (2) ◽  
pp. 209-214 ◽  
Author(s):  
Thor V.M. Fajardo ◽  
Marcelo Eiras ◽  
Henrique P. Santos ◽  
Osmar Nickel ◽  
Gilmar B. Kuhn
Keyword(s):  
Rio Grande ◽  
Rio Grande Do Sul ◽  
Rt Pcr ◽  
Cabernet Franc ◽  
Rupestris Stem Pitting ◽  
Stem Pitting ◽  
Vitis Spp

Rupestris stem pitting associated virus (RSPaV) é o agente causal das "caneluras do tronco de Rupestris" da videira (Vitis spp.). Neste trabalho, um isolado de RSPaV, encontrado em videiras cv. Cabernet Franc no Rio Grande do Sul, foi estudado. O vírus foi detectado biologicamente, por enxertia em videira indicadora cv. Rupestris du Lot, em 26,2% das amostras avaliadas. A seqüência parcial do gene da replicase do RSPaV, isolado sul-brasileiro, com 831 nucleotídeos amplificados por RT-PCR e 276 aminoácidos deduzidos, apresentou maior identidade de nucleotídeos (98,1%) e aminoácidos deduzidos (99,6%), com dois isolados norte-americanos. O RSPaV estudado apresentou baixa homologia (37-41%) com outros vírus do gênero Foveavirus. A maioria das mudas de videira cv. C. Franc infetadas com RSPaV apresentou diminuição no potencial fotossintético (2,68 a 5,12 vezes) e aumento na taxa respiratória no escuro quando comparadas a mudas sadias, salientando os impactos que esse vírus pode proporcionar no potencial produtivo de videiras.

scholarly journals RT-PCR Based Detection of Rupestris stem pitting associated virus Within Field-Grown Grapevines Throughout the Year

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 617-620 ◽  
Author(s):  
Sandra Stewart ◽  
Annette Nassuth
Keyword(s):  
Internal Control ◽  
Virus Detection ◽  
Pinot Noir ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Cabernet Franc ◽  
Reliable Source ◽  
Polymerase Chain ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

The presence of Rupestris stem pitting associated virus (RSPaV) can go unnoticed since symptoms appear only if additional viruses are present. Detection by reverse transcription-polymerase chain reaction (RT-PCR) is possible; however, this assay could be unreliable if the tissue that is being tested has detection-interfering compounds, or if the virus has a low titer. This paper reports on (i) use of a recently developed extraction method and internal control to determine which tissues from field-grown grapevines yield extracts that are reliable for virus detection by RT-PCR, and (ii) a survey for RSPaV of different tissues from the Vitis vinifera varieties Riesling, Chardonnay, Cabernet Franc, Merlot, Sauvignon Blanc, Pinot Noir, and Gamay, as well as from the rootstocks 3309 and Riparia, which were harvested in Ontario, Canada, at different times of the year. Amplifiable extracts were obtained from virtually all bud, shoot tip, seed, and cane samples tested. Detectable amounts of RSPaV were generally found in all tissues of infected plants except young buds collected in the summer. A combination of three single buds from dormant canes, less time-consuming than the preparation of cane shavings, was a reliable source for RSPaV detection.

scholarly journals First Report of Grapevine Pinot Gris Virus and Grapevine Rupestris Stem Pitting-Associated Virus in Grapevine in Belgium

Plant Disease ◽  
2020 ◽  
Vol 104 (6) ◽  
pp. 1879
Author(s):  
S. Massart ◽  
L. Vankerkoven ◽  
A. G. Blouin ◽  
S. Nourinejhad Zarghani ◽  
T. Wetzel
Keyword(s):  
First Report ◽  
Grapevine Pinot Gris Virus ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

scholarly journals Desempenho agronômico de videiras com e sem sintomas de viroses, e comparação molecular de isolados virais

2015 ◽  
Vol 50 (7) ◽  
pp. 541-550 ◽  
Author(s):  
Monique Bezerra Nascimento ◽  
Thor Vinícius Martins Fajardo ◽  
Marcelo Eiras ◽  
Ana Beatriz Costa Czermainski ◽  
Osmar Nickel ◽  
...  
Keyword(s):  
Grapevine Virus ◽  
Rt Pcr ◽  
Grapevine Virus A ◽  
Grapevine Virus B ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

Resumo: O objetivo deste trabalho foi avaliar os efeitos de viroses em videiras sintomáticas e assintomáticas sobre as variáveis agronômicas relacionadas ao vigor das plantas e à qualidade enológica da uva, e comparar os isolados virais obtidos nessas duas condições. Realizaram-se dois experimentos com quatro cultivares. Todas as plantas foram indexadas, por meio da reação em cadeia da polimerase via transcrição reversa (RT-PCR) em tempo real, quanto à provável ocorrência dos seguintes vírus: Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine leafroll-associated virus (GLRaV-1 ao -4, GLRaV-4 estirpe 5), Grapevine rupestris stem pitting-associated virus (GRSPaV) e Grapevine fleck virus (GFkV). As variáveis avaliadas foram: número de gemas brotadas e não brotadas, número de ramos com ou sem cachos, número total de gemas, número de cachos, massa de cachos frescos, massa total de bagas, massa do engaço, número de bagas por cacho, massa média de baga, sólidos solúveis totais, acidez total titulável, pH, massa de ramos podados ou diâmetros do tronco do porta-enxerto e da copa. Os efeitos negativos foram mais pronunciados nas plantas com sintomas de viroses; no entanto, constatou-se frequentemente que plantas sem sintomas também estavam infectadas. A análise molecular de GRSPaV, GVA e GLRaV-2, isolados de plantas sintomáticas e assintomáticas, resultou em alta percentagem de identidade de nucleotídeos entre isolados homólogos.

PlWRKY70: a Paeonia lactiflora transcription factor that sensitively responds to low-temperature, salt, and waterlogging stresses

2020 ◽  
Vol 100 (2) ◽  
pp. 146-155 ◽  
Author(s):  
Caiyun Han ◽  
Junjie Li ◽  
Yan Ma ◽  
Jing Guo ◽  
Xianfeng Guo ◽  
...  
Keyword(s):  
Low Temperature ◽  
Abiotic Stresses ◽  
Wrky Domain ◽  
Paeonia Lactiflora ◽  
Paeonia Suffruticosa ◽  
Coding Region ◽  
Rt Pcr ◽  
Reading Frame ◽  
Group Iii ◽  
High Level

The WRKY family is a specific super gene family in plants that plays a significant regulatory role in abiotic stress in plants. In this paper, the PlWRKY70 gene was cloned by RT-PCR from Paeonia lactiflora ‘Da Fugui’ buds (GenBank accession no. KU891819). The open reading frame of the gene was 936 bp in length, encoding 311 amino acids. The PlWRKY70 gene contained a WRKY domain in its coding region that belonged to the group III WRKY family and was evolutionarily the closest to Paeonia suffruticosa. PlWRKY70 was widely expressed and found at an extremely high level in buds. Moreover, the PlWRKY70 protein was mostly detected in the nucleus. The expression of PlWRKY70 was remarkably influenced by different abiotic stresses with completely different patterns. It could be significantly induced by low-temperature and salt stress, rapidly reaching peak levels after the initial 4 or 8 h of the stress treatment, whereas under waterlogging stress, it was considerably suppressed, dramatically dropping to minimum levels after 2 h of treatment. These profiles suggested that PlWRKY70 was sensitive to low-temperature, salt, and waterlogging stresses in P. lactiflora.

scholarly journals A Survey of Virginia Vineyards Revealed High Incidences of Grapevine Rupestris Stem Pitting-Associated Virus, Grapevine Red Blotch Virus, and Two Mealybug Species

2019 ◽  
Vol 20 (4) ◽  
pp. 207-214 ◽  
Author(s):  
Taylor Jones ◽  
Mizuho Nita
Keyword(s):  
Virus Disease ◽  
Grapevine Virus ◽  
Factors Affecting ◽  
Grapevine Virus A ◽  
Grapevine Virus B ◽  
Grapevine Pinot Gris Virus ◽  
Potential Factors ◽  
Pseudococcus Viburni ◽  
Rupestris Stem Pitting ◽  
Stem Pitting

We investigated the prevalence of viruses infecting grapevines in Virginia, identity of disease vectors, and potential factors affecting virus incidence. Tested viruses were grapevine leafroll-associated virus (GLRaV-1 and -4), grapevine fleck virus (GFkV), grapevine virus A (GVA), grapevine virus B (GVB), grapevine rupestris stem pitting-associated virus (GRSPaV), tomato ringspot virus (ToRSV), grapevine vein clearing virus (GVCV), grapevine red blotch virus (GRBV), and grapevine Pinot gris virus (GPGV). We documented wide distributions of GRSPaV (54%) and GRBV (24%) and common occurrences of grape (Pseudococcus maritimus) and Gill’s (Ferrisia gilli) mealybugs among vineyards. This is the first report of GLRaV-1, GLRaV-4, GVA, GVB, GRSPaV, and obscure mealybug (Pseudococcus viburni) in Virginia. We also documented significant association (P ≤ 0.05) of the presence of mealybugs and GVA and GVB. With younger vines, significantly lower incidences were found for viruses that were listed (i.e., tested for a certification) by the Foundation Planting Service’s and the National Clean Plant Network’s grape programs. On the other hand, there was a lack of the age effect on incidence of GRSPaV and GRBV, which were not listed until recently. These results suggest the importance of clean plant material and vector management for grapevine virus disease management in Virginia.

scholarly journals Coupled Translation of the Second Open Reading Frame of M2 mRNA Is Sequence Dependent and Differs Significantly within the Subfamily Pneumovirinae

2007 ◽  
Vol 81 (16) ◽  
pp. 8488-8496 ◽  
Author(s):  
Phillip Spencer Gould ◽  
Andrew John Easton
Keyword(s):  
Secondary Structure ◽  
Open Reading Frame ◽  
Start Codon ◽  
Alternative Mechanism ◽  
Coding Region ◽  
Translational Initiation ◽  
Reading Frame ◽  
Avian Pneumovirus ◽  
Syncytial Virus ◽  
Overlapping Region

ABSTRACT Coupled translation, first described in the M2 gene of pneumovirus respiratory syncytial virus (RSV), is an alternative mechanism of translational initiation in which the ribosomes which translate the first (M2-1) open reading frame (ORF) move a short distance upstream after termination and reinitiate translation from a second (M2-2) overlapping ORF. Here, we show that the same mechanism occurs in two closely related viruses, avian pneumovirus (APV) and pneumonia virus of mice (PVM), although with markedly different efficiencies. To identify the reasons for the variation in efficiency of coupled expression between RSV and APV, we used chimeric M2-1 genes containing different lengths of the M2-1 ORF from each virus. An essential component allowing coupled expression in the chimeras was a segment from the RSV M2-1 coding region containing a high degree of secondary structure. Additional sequences at the 5′ end of the RSV M2-1 ORF also promoted coupled translation when the region with high levels of secondary structure was present. These data indicate that at least two distant parts of the mRNA transcript, together with a suitable overlapping region, are involved in the coupling process. Replacement of the last 102 nucleotides of the RSV M2-1 ORF with the equivalent APV sequence showed identical levels of coupled translation. Thus, the overlapping region can direct the ribosome back onto the start codon of the second ORF while the upstream coding sequence of the M2-1 ORF determines the levels of coupled expression.

Sign in / Sign up

Export Citation Format

Share Document