Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar ‘Meunier’ in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera ‘Meunier’ leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5’ untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3’-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected ‘Meunier’ grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the ‘Meunier’ grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5’ untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3’-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected ‘Meunier’ grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the ‘aphid transmission protein’ producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was found positive for GEV-1 in gapevine in France.

Incidence of GLMD-Like Symptoms on Grapevines Naturally Infected by Grapevine Pinot gris virus, Boron Content and Gene Expression Analysis of Boron Metabolism Genes

Grapevine Pinot gris virus (GPGV) is considered to be a causal agent of Grapevine Leaf Mottling and Deformation (GLMD) disease that has been reported worldwide through the grapevine-growing regions. Seven grapevines that were collected from a vineyard in the Czech Republic were tested for the presence of GPGV in leaf and phloem tissues. Each of the seven grapevines was infected by GPGV, from which sic symptoms were mostly shown without a typical mottling. The phylogeny based on RNA-dependent RNA polymerase and movement/coat protein sequences indicated the same origin of the GPGV isolates. The GPGV titer was the highest in the grapevines with the highest GLMD-like symptoms; however, some of the grapevines with milder GLMD-like symptoms had a lower GPGV titer than the asymptomatic grapevine. Soil analysis showed uneven boron content in the direct vicinity of the grapevines, while the boron content in the grapevines was more, even showing no boron deficiency. The quantitative analysis of selected gene expressions associated with boron efflux and transport only partially explained the boron content in the soil and grapevines and only in the grapevines growing in soils with the highest or lowest boron contents. The VvBor2 and VvNIP5 genes had a higher expression and VvNIP6 had a lower expression in the grapevine growing in the soil with the lowest boron content, while a low expression of VvBor1 and VvBor2 was observed in the grapevine that was grown in the soil with the highest boron content.

Trigger and suppression of antiviral defenses by grapevine Pinot gris virus (GPGV): novel insights into virus-host interaction

Grapevine Pinot gris virus (GPGV) is an emerging trichovirus that has been putatively associated with a novel grapevine disease known as grapevine leaf mottling and deformation (GLMD). Yet the role of GPGV in GLMD disease is poorly understood since it has been detected both in symptomatic and symptomless grapevines. We exploited a recently constructed GPGV infectious clone (pRI::GPGV-vir) to induce an antiviral response in Nicotiana benthamiana plants. In silico prediction of virus-derived small interfering RNAs (vsiRNAs) and gene expression analyses revealed the involvement of DCL4, AGO5 and RDR6 genes during GPGV infection, suggesting the activation of the post-transcriptional gene-silencing (PTGS) pathway as a plant antiviral defense. PTGS suppression assays in transgenic N. benthamiana 16c plants revealed the ability of the GPGV coat protein to suppress RNA silencing. This work provides novel insights on the interaction between GPGV and its host, revealing the ability of the virus to trigger and suppress antiviral RNA silencing.

Distinct responses of Vitis aestivalis ‘Norton’ and Vitis vinifera ‘Kishmish Vatkana’ to seven viruses revealed by small RNA sequencing

Grapevines are frequently infected by multiple viruses. Our previous study showed that ‘Norton’ grapevine (Vitis aestivalis) is resistant to grapevine vein clearing virus, a DNA virus in the family Caulimoviridae. To study the reaction of ‘Norton’ to RNA viruses, we transferred seven RNA viruses to ‘Norton’ from ‘Kishmish Vatkana’ (‘KV’) (Vitis vinifera) via graft-transmission. We profiled viral small RNAs (vsRNAs) of the seven viruses and compared viral titers in ‘Norton’ and ‘KV’. Total vsRNAs of grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, grapevine virus A (GVA) and grapevine Pinot gris virus (GPGV) were significantly less abundant in ‘Norton’ than in ‘KV’, but total vsRNAs of grapevine fleck virus (GFkV) were more abundant in ‘Norton’ than in ‘KV’. Total vsRNAs of grapevine rupestris stem pitting-associated virus (GRSPaV) were not different between ‘Norton’ and ‘KV’. Grafting direction of ‘Norton’ to ‘KV’ or ‘KV’ to ‘Norton’ did not affect the quantity of vsRNAs. The genome coverage of GLRaV-1, GLRaV-2, GLRaV-3 and GVA vsRNAs was lower in ‘Norton’ than ‘KV’. The 21-nt and 22-nt classes of vsRNAs were predominant for all seven viruses. Virus quantification by qPCR indicated that GLRaV-1 was undetectable in ‘Norton’, GLRaV-2, GLRaV-3, and GVA were less abundant in ‘Norton’, but GFkV was more abundant in ‘Norton’ than in ‘KV’. These results demonstrated that ‘Norton’ grapevine suppresses GLRaV-1, GLRaV-2, GLRaV-3, and GVA, but supports GFkV in comparison with ‘KV’. This study revealed new facets of complex molecular interactions between grapevines and multiple viruses.

Biological evidence and molecular modeling of a grapevine Pinot gris virus outbreak in a vineyard

Since its identification in 2003, little has been revealed about the spread of grapevine Pinot gris virus (GPGV), an emerging grapevine virus. According to studies from Italy, GPGV transmission in the vineyard can be fast but progressive over the years. To gain new insights into the spread of GPGV infections, we tested 67 grapevines in a single vineyard parcel in southern France. These vines were sampled over eight years (2013-2020) and tested for GPGV by RT-PCR using a new primer pair designed from the recently described genetic diversity of GPGV worldwide. While focusing on a portion of the samples (20), we observed a drastic increase in newly GPGV-infected vines from 2014 (5%, 1 of 20) to 2015 (80%, 16 of 20) and 2016 (90%, 18 of 20). Infected vines were scattered throughout the vineyard with no distinct pattern of distribution and some rare vines remained negative through 2020. Using all available genomic information, we performed Bayesian-based phylogeographic analyses that identified a major intra-vineyard transmission in 2014-2015. To test our model, we analyzed 47 additional grapevines and confirmed the outbreak of GPGV in 2015, validating our in-silico projection. Interestingly, some grapevines remained negative throughout the study, in spite of their close proximity to infected plants. These results raise questions on the dynamic of vector populations and environmental conditions that may be required for virus spread to occur in the vineyard.

Grapevine Pinot gris virus infecting grapevines in Romania - Short Communicaiton

Grapevine Pinot gris virus (GPGV) has been identified in many grape growing countries of the world since 2012. The aim of this work was to investigate the presence of GPGV on some accessions collected from a germplasm collection, in addition to the propagation material and clonal selection samples. During 2019–2020, a total of 199 samples have been analysed by a double antibody sandwich – enzyme-linked immunosorbent assay (DAS-ELISA) for the presence of GPGV, Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus-1+3 (GLRaV-1+3) and Grapevine fleck virus (GFkV). Among them, 107 samples (53.76%) showed a GPGV-infection, associated with or without symptoms on the leaves (deformations, chlorosis, mosaic, wrinkles) or stunting plants. The distribution of infected varieties showed a high rate of infection in old varieties (37.38%), followed by clones (32.71%), rootstocks (11.21%), clonal selections (9.35%) and new varieties (9.35%). The tests revealed the association of GPGV with GFkV (5 cases) and GLRaV-1+3 (2 cases). GPGV should be included in the rules of grapevine certification schemes for the production of virus-free mother plants.