Incidence of 14 grapevine viruses in Korean vineyards

The incidence of grapevine virus infections in Korean vineyards was investigated from July to October, 2020. A total of 177 petiole samples were collected from two or three different cultivars in each of four different regions; these were examined by reverse transcription-polymerase chain reaction assay for the presence of 14 major viruses. The overall occurrence of grapevine viruses was 91.0%, and the level of incidence was high irrespective of region or cultivar. The predominant viruses were grapevine leafroll-associated virus 3 (80.2%), grapevine fleck virus (70.6%), and grapevine rupestris stem pitting-associated virus (49.2%). Most grapevines were infected with multiple viruses, suggesting that Korean vineyards are likely to suffer economic losses resulting from viral diseases. This is the first extensive survey performed in Korea to observe the outbreak status of diverse grapevine viruses; surveys of this type can provide important information for the management of grapevine viruses in Korea.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar ‘Meunier’ in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera ‘Meunier’ leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5’ untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3’-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected ‘Meunier’ grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the ‘Meunier’ grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5’ untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3’-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected ‘Meunier’ grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the ‘aphid transmission protein’ producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was found positive for GEV-1 in gapevine in France.

Prevalence and genetic diversity of viruses associated with rugose wood complex in Greek vineyards

Rugose wood is one of the most important disease syndromes of grapevine and it has been associated with at least three viruses: grapevine rupestris stem pitting associated virus (GRSPaV), grapevine virus A (GVA) and grapevine virus B (GVB). All three viruses show a worldwide distribution pattern, and their genetic composition has been the focus of extensive research over the past years. Despite their first record in Greece almost 20 years ago, there is a lack of knowledge on the distribution and genetic variability of their populations in Greek vineyards. In this context, we investigated the distribution of GRSPaV, GVA and GVB in rootstocks, self-rooted and grafted grapevine cultivars, originating from different geographic regions that are representing important viticultural areas of Greece. Three new RT-PCR assays were developed for the reliable detection of GRSPaV, GVA and GVB. Our results indicated that GVA is the most prevalent in Greek vineyards, followed by GRSPaV and GVB. However, virus incidence differed among self-rooted and grafted grapevine cultivars or rootstocks tested. Selected isolates from each virus were further molecularly characterized to determine their phylogenetic relationships. All three viruses exhibited high nucleotide diversity, which was depicted in the constructed phylogenetic trees. Isolates from Greece were placed in various phylogroups, reinforcing the scenario of multiple introductions of GVA, GVB and GRSPaV in Greece and highlighting the effect of different transmission modes in the evolutionary course of the three viruses.

Distribution and Genetic Diversity of Grapevine Viruses in Russia

Viral diseases can seriously damage the vineyard productivity and the quality of grape and wine products. Therefore, the study of the species composition and range of grapevine viruses is important for the development and implementation of strategies and tactics to limit their spread and increase the economic benefits of viticulture. In 2014–2019, we carried out a large-scale phytosanitary monitoring of Russian commercial vineyards in the Krasnodar region, Stavropol region and Republic of Crimea. A total of 1857 samples were collected and tested for the presence of Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine leafroll-associated virus-1 (GLRaV-1), Grapevine leafroll-associated virus-2 (GLRaV-2), Grapevine leafroll-associated virus-3 (GLRaV-3), Grapevine fanleaf virus (GFLV), and Grapevine fleck virus (GFkV) using RT-PCR. Out of all samples tested, 54.5% were positive for at least one of the viruses (GRSPaV, GVA, GLRaV-1, GLRaV-2, GLRaV-3, GFLV, GFkV) in the Stavropol region, 49.8% in the Krasnodar region and 49.5% in the Republic of Crimea. Some plants were found to be infected with several viruses simultaneously. In the Republic of Crimea, for instance, a number of plants were infected with five viruses. In the Krasnodar region and the Republic of Crimea, 4.7% and 3.3% of the samples were predominantly infected with both GFkV and GRSPaV, whereas in the Stavropol region, 6% of the selected samples had both GLRaV-1 and GVA infections. We carried out a phylogenetic analysis of the coat protein genes of the detected viruses and identified the presence of GVA of groups I and IV, GRSPaV of groups BS and SG1, GLRaV-1 of group III, GLRaV-2 of groups PN and H4, GLRaV-3 of groups I and III. The results obtained make it possible to assess the viral load and the distribution of the main grapevine viruses on plantations in the viticultural zones of Russia, emphasizing the urgent need to develop and implement long-term strategies for the control of viral diseases of grapes.

Distinct responses of Vitis aestivalis ‘Norton’ and Vitis vinifera ‘Kishmish Vatkana’ to seven viruses revealed by small RNA sequencing

Grapevines are frequently infected by multiple viruses. Our previous study showed that ‘Norton’ grapevine (Vitis aestivalis) is resistant to grapevine vein clearing virus, a DNA virus in the family Caulimoviridae. To study the reaction of ‘Norton’ to RNA viruses, we transferred seven RNA viruses to ‘Norton’ from ‘Kishmish Vatkana’ (‘KV’) (Vitis vinifera) via graft-transmission. We profiled viral small RNAs (vsRNAs) of the seven viruses and compared viral titers in ‘Norton’ and ‘KV’. Total vsRNAs of grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, grapevine virus A (GVA) and grapevine Pinot gris virus (GPGV) were significantly less abundant in ‘Norton’ than in ‘KV’, but total vsRNAs of grapevine fleck virus (GFkV) were more abundant in ‘Norton’ than in ‘KV’. Total vsRNAs of grapevine rupestris stem pitting-associated virus (GRSPaV) were not different between ‘Norton’ and ‘KV’. Grafting direction of ‘Norton’ to ‘KV’ or ‘KV’ to ‘Norton’ did not affect the quantity of vsRNAs. The genome coverage of GLRaV-1, GLRaV-2, GLRaV-3 and GVA vsRNAs was lower in ‘Norton’ than ‘KV’. The 21-nt and 22-nt classes of vsRNAs were predominant for all seven viruses. Virus quantification by qPCR indicated that GLRaV-1 was undetectable in ‘Norton’, GLRaV-2, GLRaV-3, and GVA were less abundant in ‘Norton’, but GFkV was more abundant in ‘Norton’ than in ‘KV’. These results demonstrated that ‘Norton’ grapevine suppresses GLRaV-1, GLRaV-2, GLRaV-3, and GVA, but supports GFkV in comparison with ‘KV’. This study revealed new facets of complex molecular interactions between grapevines and multiple viruses.

Cultivated and wild grapevines in Tennessee possess overlapping but distinct virus populations

Viruses and viroids prevalent in a population of 42 wild grapevines (i.e., free-living, uncultivated grapevines; Vitis spp.) were compared to those in a population of 85 cultivated grapevines collected in Tennessee, USA by RNA-seq analysis of pools of ribosomal RNA-depleted total RNA. The sequences of 10 viruses (grapevine fleck virus, grapevine leafroll-associated virus 2, grapevine rupestris stem pitting-associated virus, grapevine Syrah virus 1, grapevine vein-clearing virus, grapevine virus B, grapevine virus E, tobacco ringspot virus, tomato ringspot virus and a novel nano-like virus) and two viroids (hop stunt viroid and grapevine yellow speckle viroid 1) were detected in both grapevine populations. Sequences of four viruses (grapevine associated tymo-like virus, grapevine leafroll-associated virus 3, grapevine red blotch virus and grapevine virus H) were identified only from cultivated grapevines. High, moderate and low numbers of sequence reads were identified only from wild grapevines for a novel caulimovirus, an enamovirus, and alfalfa mosaic virus, respectively. The presence of most virus sequences and both viroids was verified independently in the original samples by reverse transcription-polymerase chain reaction followed by Sanger sequencing. Comparison of viral sequences shared by both populations showed that cultivated and wild grapevines harbored distinct sequence variants, which suggests that there was limited virus movement between the two populations. Collectively, this study represents the first unbiased survey of viruses and viroids in both cultivated and wild grapevines within a defined geographic region.

Predominance and Diversity of GLRaV-3 in Native Vines of Mediterranean Croatia

Sixteen grapevine cultivars from Mediterranean Croatia were surveyed for the presence of 10 of the most economically important grapevine viruses. The presence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine leafroll associated virus-1, -2, and -3 (GLRaV-1; GLRaV-2 and GLRaV-3), Grapevine virus A (GVA) and B (GVB), Grapevine fleck virus (GFkV), Grapevine rupestris stem pitting associated virus (GRSPaV), and Grapevine Pinot gris virus (GPGV) were tested by reverse transcription polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA). All 71 analyzed clones were positive for the presence of one or more viruses. The most abundant one, detected in almost 95% of samples was GLRaV-3. In most of cases it was reported in mixed infections with GVA, GRSPaV, and GPGV. Virus genomes of GLRaV-3 infected vines were further characterized molecularly in order to determine their genetic diversity. Different genomic variants of heat shock 70 protein homologue (HSP70h) were identified by single-strand conformation polymorphism (SSCP) and sequenced. Sequence analysis confirmed their clustering into phylogenetic group I and/or phylogenetic group II. This study emphasizes the wide virus heterogenicity in Mediterranean vines and the predominant presence of GLRaV-3 phylogenetic groups I and II, either individually or in combination.

Biological and molecular interplay between two viruses and powdery and downy mildews in two grapevine cultivars

Grapevine may be affected simultaneously by several pathogens whose complex interplay is largely unknown. We studied the effects of infection by two grapevine viruses on powdery mildew and downy mildew development and the molecular modifications induced in grapevines by their multiple interactions. Grapevine fanleaf virus (GFLV) and grapevine rupestris stem pitting-associated virus (GRSPaV) were transmitted by in vitro-grafting to Vitis vinifera cv Nebbiolo and Chardonnay virus-free plantlets regenerated by somatic embryogenesis. Grapevines were then artificially inoculated in the greenhouse with either Plasmopara viticola or Erysiphe necator spores. GFLV-infected plants showed a reduction in severity of the diseases caused by powdery and downy mildews in comparison to virus-free plants. GFLV induced the overexpression of stilbene synthase genes, pathogenesis-related proteins, and influenced the genes involved in carbohydrate metabolism in grapevine. These transcriptional changes suggest improved innate plant immunity, which makes the GFLV-infected grapevines less susceptible to other biotic attacks. This, however, cannot be extrapolated to GRSPaV as it was unable to promote protection against the fungal/oomycete pathogens. In these multiple interactions, the grapevine genotype seemed to have a crucial role: in ‘Nebbiolo’, the virus-induced molecular changes were different from those observed in ‘Chardonnay’, suggesting that different metabolic pathways may be involved in protection against fungal/oomycete pathogens. These results indicate that complex interactions do exist between grapevine and its different pathogens and represent the first study on a topic that still is largely unexplored.

A Diverse Virome of Leafroll-Infected Grapevine Unveiled by dsRNA Sequencing

Quebec is the third-largest wine grape producing province in Canada, and the industry is constantly expanding. Traditionally, 90% of the grapevine cultivars grown in Quebec were winter hardy and largely dominated by interspecific hybrid Vitis sp. cultivars. Over the years, the winter protection techniques adopted by growers and climate changes have offered an opportunity to establish V. vinifera L. cultivars (e.g., Pinot noir). We characterized the virome of leafroll-infected interspecific hybrid cultivar and compared it to the virome of V. vinifera cultivar to support and facilitate the transition of the industry. A dsRNA sequencing method was used to sequence symptomatic and asymptomatic grapevine leaves of different cultivars. The results suggested a complex virome in terms of composition, abundance, richness, and phylogenetic diversity. Three viruses, grapevine Rupestris stem pitting-associated virus, grapevine leafroll-associated virus (GLRaV) 3 and 2 and hop stunt viroid (HSVd) largely dominated the virome. However, their presence and abundance varied among grapevine cultivars. The symptomless grapevine cultivar Vidal was frequently infected by multiple virus and viroid species and different strains of the same virus, including GLRaV-3 and 2. Our data show that viruses and viroids associated with the highest number of grapevines expressing symptoms included HSVd, GLRaV-3 and GLRaV-2, in gradient order. However, co-occurrence analysis revealed that the presence of GLRaV species was randomly associated with the development of virus-like symptoms. These findings and their implications for grapevine leafroll disease management are discussed.