High Sensitivity Fiber Refractive Index Sensors Based on Asymmetric Supermodes Interference in Tapered Four Core Fiber

We demonstrate high sensitivity fiber refractive index (RI) sensor based on asymmetric supermode interferences in tapered four core fiber (TFCF). To make TFCF-based RI sensors, the whitelight was launched into any one of the cores to define the excitation orientation and is called a vertex-core excitation scheme. When the four-core fiber (FCF) was gradually tapered, the four cores gathered closer and closer. Originally, the power coupling occurred between its two neighboring cores first and these three cores are grouped to produce supermodes. Subsequently, the fourth diagonal core enters the evanescent field overlapping region to excite asymmetric supermodes interferences. The output spectral responses of the two cores next to the excitation core are mutually in phase whereas the spectral responses of the diagonal core are in phase and out of phase to that of the excitation core at the shorter and longer wavelengths, respectively. Due to the lowest limitation of the available refractive index of liquids, the best sensitivity can be achieved when the tapered diameter is 10 μm and the best RI sensitivity S is 3249 nm/RIU over the indices ranging from 1.41–1.42. This is several times higher than that at other RI ranges due to the asymmetric supermodes.

Uniformity Detection for Straws Based on Overlapping Region Analysis

Nowadays, the advanced comprehensive utilization and the complete prohibition of burning fully covered straws in croplands have become increasingly important in agriculture engineering. As a kind of direct straw-mulching method in China, conservation tillage with straw smashing is an effective method to reduce pollution and enhance fertility. In view of the high straw-returning yields, complicated manual operation, and the poor performance of straw detection with machine vision, this study introduces a novel form of uniformity detection for straws based on overlapping region analysis. An image-processing technology using a novel overlapping region analysis was proposed to overcome the inefficiency and low precision resulting from the manual identification of the straw uniformity. In this study, the debris in the gray map was removed according to region characteristics. Through using morphological theory with overlapping region analysis in low-density cases, straws of appropriate length can be identified and then uniformity detection can be accomplished. Compared with traditional threshold segmentation methods, the advantages of an accurate identification, fast operation, and high efficiency contribute to the better performance of the innovative overlapping region analysis. Finally, the proposed algorithm was verified through detecting the uniformity in low-density cases, with an average accuracy rate of 97.69%, providing a novel image recognition solution for automatic straw-mulching systems.

Detection and genetic characterization of the novel torque teno virus group 6 in Taiwanese general population

Torque teno virus (TTV) is one of the most common human viruses and can infect an individual with multiple genotypes chronically and persistently. TTV group 6 is a recently discovered phylogenetic group first isolated from eastern Taiwan indigenes, but whether the TTV group 6 was also prevalent in the general population still unknown. One hundred and three randomly collected blood samples from general population and 66 TTV positive DNA samples extracted from Taiwan indigenes were included. A group-6-specific PCR was developed for re-screen over TTV positive samples. Two TTV group 6 positive samples from general population were cloned and sequenced for identifying mix-infected TTVs and confirming their classification by maximum-likelihood and Bayesian inference phylogeny. TTV group 6 can be detected in 4.5% (4/89) and 7.6% (5/66) of TTV positive samples from Taiwanese general population and eastern Taiwan indigenes, respectively. Sample VC09 was mix-infected with TTV groups 3 and 6. Sample VC99 was mix-infected with TTV groups 3, 4 and 6. A highly diverse triple overlapping region was observed, which may represent a unique phenomenon of TTV. The group-6-specific PCR can successfully detect TTV group 6. TTV group 6 may be prevalent worldwide regardless of the geographic region and/or ethnic groups.

Snail Upregulates Transcription of FN, LEF, COX2, and COL1A1 in Hepatocellular Carcinoma: A General Model Established for Snail to Transactivate Mesenchymal Genes

SNA is one of the essential EMT transcriptional factors capable of suppressing epithelial maker while upregulating mesenchymal markers. However, the mechanisms for SNA to transactivate mesenchymal markers was not well elucidated. Recently, we demonstrated that SNA collaborates with EGR1 and SP1 to directly upregulate MMP9 and ZEB1. Remarkably, a SNA-binding motif (TCACA) upstream of EGR/SP1 overlapping region on promoters was identified. Herein, we examined whether four other mesenchymal markers, lymphoid enhancer-binding factor (LEF), fibronectin (FN), cyclooxygenase 2 (COX2), and collagen type alpha I (COL1A1) are upregulated by SNA in a similar fashion. Expectedly, SNA is essential for expression of these mesenchymal genes. By deletion mapping and site directed mutagenesis coupled with dual luciferase promoter assay, SNA-binding motif and EGR1/SP1 overlapping region are required for TPA-induced transcription of LEF, FN, COX2 and COL1A1. Consistently, TPA induced binding of SNA and EGR1/SP1 on relevant promoter regions of these mesenchymal genes using ChIP and EMSA. Thus far, we found six of the mesenchymal genes are transcriptionally upregulated by SNA in the same fashion. Moreover, comprehensive screening revealed similar sequence architectures on promoter regions of other SNA-upregulated mesenchymal markers, suggesting that a general model for SNA-upregulated mesenchymal genes can be established.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar ‘Meunier’ in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera ‘Meunier’ leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5’ untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3’-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected ‘Meunier’ grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the ‘Meunier’ grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5’ untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3’-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected ‘Meunier’ grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the ‘aphid transmission protein’ producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was found positive for GEV-1 in gapevine in France.

Terrestrial exospheric dayside H-density profile at 3–15 R_e from UVIS/HDAC and TWINS Lyman-α data combined

Terrestrial ecliptic dayside observations of the exospheric Lyman-α column intensity between 3–15 Earth radii (Re) by UVIS/HDAC at CASSINI have been analysed to derive the neutral exospheric H-density profile at the Earth's ecliptic dayside in this radial range. The data were measured during CASSINIS's swing by manoeuvre at the Earth on 18 August 1999 and are published by (Werner et al., 2004). In this study the dayside HDAC Lyman-α observations published by (Werner et al., 2004) are compared to calculated Lyman-α intensities based on the 3D H-density model derived from TWINS Lyman-α observations between 2008–2010 (Zoennchen et al., 2015). It was found, that both Lyman-α profiles show a very similar radial dependence in particular between 3–8 Re. Between 3.0–5.5 Re impact distance Lyman-α observations of both TWINS and UVIS/HDAC are existing at the ecliptic dayside. In this overlapping region the cross-calibration of the HDAC profile against the calculated TWINS profile was done, assuming, that the exosphere there was similar for both due to comparable space weather conditions. As result of the cross-calibration the conversion factor between counts/s and Rayleigh fc = 3.285 [counts/s/R] is determined for these HDAC observations. Using this factor the radial H-density profile for the Earths ecliptic dayside was derived from the UVIS/HDAC observations, which constrained the neutral H-density there at 10 Re to a value of 35 cm−3. Furthermore, a faster radial H-density decrease was found at distances above 8 Re (≈ r−3) compared to the lower distances 3–7 Re (≈ r−2.37). This increased loss of neutral H above 8 Re might indicate a higher rate of H ionization in the vicinity of the magnetopause at 9–11 Re (near sub solar point) and beyond, because of increasing charge exchange interactions of exospheric H atoms with solar wind ions outside the magnetosphere.

A Cost Function for the Uncertainty of Matching Point Distribution on Image Registration

Computing the homography matrix using the known matching points is a key step in computer vision for image registration. In practice, the number, accuracy, and distribution of the known matching points can affect the uncertainty of the homography matrix. This study mainly focuses on the effect of matching point distribution on image registration. First, horizontal dilution of precision (HDOP) is derived to measure the influence of the distribution of known points on fixed point position accuracy on the image. The quantization function, which is the average of the center points’ HDOP* of the overlapping region, is then constructed to measure the uncertainty of matching distribution. Finally, the experiments in the field of image registration are performed to verify the proposed function. We test the consistency of the relationship between the proposed function and the average of symmetric transfer errors. Consequently, the proposed function is appropriate for measuring the uncertainty of matching point distribution on image registration.

Adaptive Multi-View Image Mosaic Method for Conveyor Belt Surface Fault Online Detection

In order to improve the accuracy and real-time of image mosaic, realize the multi-view conveyor belt surface fault online detection, and solve the problem of longitudinal tear of conveyor belt, we in this paper propose an adaptive multi-view image mosaic (AMIM) method based on the combination of grayscale and feature. Firstly, the overlapping region of two adjacent images is preliminarily estimated by establishing the overlapping region estimation model, and then the grayscale-based method is used to register the overlapping region. Secondly, the image of interest (IOI) detection algorithm is used to divide the IOI and the non-IOI. Thirdly, only for the IOI, the feature-based partition and block registration method is used to register the images more accurately, the overlapping region is adaptively segmented, the speeded up robust features (SURF) algorithm is used to extract the feature points, and the random sample consensus (RANSAC) algorithm is used to achieve accurate registration. Finally, the improved weighted smoothing algorithm is used to fuse the two adjacent images. The experimental results showed that the registration rate reached 97.67%, and the average time of stitching was less than 500 ms. This method is accurate and fast, and is suitable for conveyor belt surface fault online detection.

Snail upregulates FN and LEF transcription negatively feed backed by PPAR-gamma: a general model established for Snail to transactivate mesenchymal genes

Background Snail (SNA) is responsible for epithelial mesenchymal transition, migration and metastasis of hepatocellular carcinoma. SNA represses the transcription of the essential epithelial marker such as E-cadherin and enhances mesenchymal markers including fibronectin and lymphoid enhancer-binding factor. Our previous studies indicated that SNA, in collaboration with EGR1 and SP1, may directly activate transcription of the mesenchymal markers, matrix degradation enzyme matrix metalloproteinases (MMP9) and zinc finger E-box binding homeobox 1 (ZEB1) in HepG2 cell stimulated by the phorbol ester tumor promoter 12-O-tetradecanoyl-phorbol 13-acetate (TPA). Besides, we pinpointed a SNA binding motif (TCACA) upstream of EGR1/SP1 overlapping region on promoters. In this study, we investigated whether LEF and FN are transcriptionally regulated by SNA in a similar fashion. Moreover, a general model for SNA-upregulated mesenchymal markers is proposed.Methods RT/PCR and Western blot were used for analyzing gene expression and shRNA technology for depleting SNA. Dual luciferase assay was used for promoter activation; deletion mapping and mutagenesis were used for confirming the indicated promoter region required for transcription activation. ChIP and EMSA were used for validating the binding of the indicated transcription factor on their putative motifs. Results SNA binding motif and E/S overlapping region are required for TPA-induced transcription of LEF and FN. These were supported by TPA-induced binding of SNA and EGR-1/SP-1 on indicated promoter regions. Moreover, a peroxisome proliferator-activated receptor γ motif upstream of SNA binding motif was found to be a negatively regulatory region in TPA-induced promoter activation of FN, LEF, MMP9 and ZEB1. This was supported by that co-treatment of a PPAR-g inhibitor, GW9662, and mutation of PPAR-g binding motif enhanced TPA-induced promoter activity and expression of the aforementioned genes whereas overexpression of PPAR-g reversed it. Moreover, comprehensive screening of the SNA-upregulated mesenchymal genes revealed similar sequence architecture on the promoter regions of the candidate genes: SNA binding motif (TCACA) coupled with a downstream EGR/SP1 overlapping region and an upstream PPAR-g binding motif. Among them COX2 and COL1A1 were found to potentially exhibit the same transcription mechanisms described above. Conclusions We established a general model for SNA-upregulated mesenchymal gene expressions negatively feed backed by PPAR-g.