scholarly journals First report of fig mosaic virus on fig in Russia

Plant Disease ◽  
2021 ◽  
Author(s):  
Sergei Chirkov ◽  
Svetlana Tsygankova ◽  
Sergey Rastorguev ◽  
Irina Mitrofanova ◽  
Svetlana Chelombit ◽  
...  
Keyword(s):  
New England ◽  
Mosaic Virus ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Mosaic Disease ◽  
Viral Gene ◽  
Illumina Platform ◽  
First Report ◽  
Fig Mosaic Virus

Fig mosaic virus (FMV) (genus Emaravirus in the family Fimoviridae) is considered the etiological agent of fig mosaic disease (FMD) that is recorded in most of the fig growing areas with an average global infection rate of 33%. The multipartite FMV genome is comprised of six negative monocistronic ssRNAs, each of which is separately encapsidated (Preising et al. 2020). Although FMD-like symptoms, which include mosaic, chlorotic ringspots, and oak leaf patterns, were observed in approximately a third of 400 fig accessions in the Nikita Botanical Gardens, Yalta, Russia (Mitrofanova et al. 2016), FMV has not been identified as the causal agent of the disease. In June of 2020, total RNA was isolated from symptomatic leaves of 59 thirty two-year-old trees representing 31 local and 27 introduced Ficus carica L. cultivars and a single F. pseudocarica Miq. tree using RNeasy Plant Mini kit (Qiagen, USA). FMV was tested by RT-PCR using primer sets E5 (Elbeaino et al. 2009) and EMARAVGP (Walia et al. 2009), which amplify a 302-bp fragment of RNA1 and a 468-bp fragment of RNA2, respectively. PCR products of the expected sizes were generated in all samples, indicating a high FMV incidence in the plantings. The genome sequences of FMV isolates from F. carica cvs. Bleuet, Kraps di Hersh, Smena, Temri, and F. pseudocarica (Fig. S1) were determined by high-throughput sequencing on MiSec Illumina platform. Double-stranded RNA was isolated from FMV-positive leaves using Viral Gene-spin™ Viral DNA/RNA Extraction Kit (iNtRON, Korea), followed by cDNA library preparation with the NEBNext® Ultra™ II RNA Library Prep Kit (New England Biolabs, USA). In average, 695,000 quality-filtered 150 bp pair-ended reads per a library were produced and used in a de novo assembly using metaSpades program version 3.14 (Nurk et al. 2017). In each of five samples, BLASTn analysis found six FMV-related contigs. The contigs spanned 99 to 100% of corresponding genomic segments of the most closely related isolates. In addition to FMV, fig cryptic virus-related contigs were also detected in some samples. The FMV contigs covering RNA1 to RNA6 had the highest identity to corresponding genomic segments of isolates AM941711 (96.5 to 96.6%), FM864225 (94.4 to 94.6%), FM991954 (97.9 to 98.2%), AB697863 (96.4 to 96.6%), AB697879 (93.3 to 93.4%), and AB697895 (95.4 to 97.0%), respectively. Five Russian isolates shared 99.2 to 100% nucleotide sequence identity, depending on the genomic segment. Their sequences were deposited in GenBank under accession numbers MW201216 to MW201230 and MW208662 to MW208676. Phylogenetic analysis of six ORFs showed that ORF1 to ORF3 and ORF6 of the Russian isolates clustered with FMV isolates from Italy while ORF4 grouped with the isolate JTT-Pa (AB697863) from Japan (Fig. S2). ORF5 of the Russian isolates formed a separate cluster with the isolates SB1 and SB2 from Serbia and JTT-Vi from Japan (AB697879 to AB697884). Incongruency of phylogenetic relationship among the genomic segments suggests reassortment among ancestors of the Russian FMV isolates. In addition, similar to the SB1, SB2 and JTT-Vi, ORF5 of the Russian isolates encodes a protein of 486 amino acid (aa) residues in contrast to the corresponding protein of Italian isolates consisting of 502 aa. To the best of our knowledge, this is the first report of FMV in Russia. This finding not only expands the information on the geographical distribution of FMV, but also extends knowledge on F. pseudocarica as a natural host of the virus.

scholarly journals First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Qiang Gao ◽  
Hai-long Ren ◽  
Wanyu Xiao ◽  
Yan Zhang ◽  
Bo Zhou ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Direct Sequencing ◽  
Rna Extraction ◽  
Viral Disease ◽  
Complete Sequence ◽  
Mosaic Disease ◽  
Shanxi Province ◽  
Watermelon Mosaic Virus ◽  
Rt Pcr ◽  
First Report

Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5’-AAGTGTGACCAAGCTTGGACTGCA-3’ and reverse: 5’-CTCACCCATTGTGCCAAAGAACGT-3’) could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch’s postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5’RACE and 3’RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.

scholarly journals First report of Coguvirus eburi infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Rt Pcr ◽  
Disease Symptoms ◽  
Total Rna ◽  
First Report ◽  
Pcr Assays

Coguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Khun et al., 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al., 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al., 2019). More recently CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data was trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (Default parameters) using high quality reads yielded 75250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9400 nts and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5’ and 3’ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al., 2018). After splitting and curation, the RNA1 contig was 6664 nts and the RNA2 contig 2686 nts. A total of 51397 and 34820 reads were used to construct these contigs resulting in an average depth of coverage of 761 and 1281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1 % of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2 respectively (Bester et al. (2021)) were used to generate amplicons. Amplicon sequences were confirmed with bi-directional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples) and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and wide-spread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.

scholarly journals First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Jin Kyong Cho ◽  
Won Kyong Cho
Keyword(s):  
Czech Republic ◽  
High Throughput Sequencing ◽  
Prunus Avium ◽  
De Novo ◽  
Protein Database ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Japanese Plum ◽  
Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

scholarly journals First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 422-422 ◽  
Author(s):  
M. Mijit ◽  
S. F. Li ◽  
S. Zhang ◽  
Z. X. Zhang
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
Ficus Carica ◽  
Pcr Analysis ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

scholarly journals First Report of Bean common mosaic virus in Cudrania tricuspidata in Korea

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 292-292 ◽  
Author(s):  
J.-K. Seo ◽  
M. Kang ◽  
O. J. Shin ◽  
H.-R. Kwak ◽  
M.-K. Kim ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
De Novo ◽  
Bean Common Mosaic Virus ◽  
Deciduous Tree ◽  
Root Bark ◽  
Genome Database ◽  
Cudrania Tricuspidata ◽  
Total Rna ◽  
First Report

Cudrania tricuspidata (Moraceae) is a deciduous tree widely distributed in East Asia, including China, Korea, and Japan. It produces delicious fruit, and its cortex and root bark have been used as a traditional medicine to treat neuritis and inflammation. As C. tricuspidata has become known as a functional food, its cultivation area and production gradually have increased in Korea. However, information of viral disease in C. tricuspidata is very limited. In September 2012, open-field-grown C. tricuspidata trees showing virus-like symptoms of mosaic, yellowing, and distortion on the leaves were found in Naju, Korea. The fruit production in the diseased trees decreased to 20 to 40% of that in healthy trees. To identify causal agent(s), total RNA was isolated from the symptomatic leaves and used to generate a transcriptome library using the TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA) according to the manufacturer's instruction. The transcriptome library was analyzed by next-generation sequencing (NGS) using an Illumina HiSeq2000 sequencer. NGS reads were quality filtered and de novo assembled by the Trinity pipeline, and the assembled contigs were analyzed against the viral reference genome database in Genbank by BLASTn and BLASTx searches (3). The entire NGS procedure was perofrmed by Macrogen Inc. (Seoul, South Korea). Among the analyzed contigs, one large contig (10,043 bp) was of viral origin. Nucleotide blast searches showed that the contig has a maximum identity of 89% (with 100% coverage) to the isolate MS1 (Genbank Accession No. EU761198) of Bean common mosaic virus (BCMV), which was isolated from Macroptilium atropurpureum in Australia. The presence of BCMV was confirmed by a commercially available double-antibody sandwich (DAS)-ELISA kit (Agdia, Elkhart, IN). To confirm the BCMV sequence obtained by NGS, two large fragments covering the entire BCMV genome were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two sets of specific primers (5′-AAAATAAAACAACTCATAAAGACAAC-3′ and 5′-AGACTGTGTCCCAGAGCATTTC-3′ to amplify the 5′ half of the BCMV genome; 5′-GCATCCTGAGATTCACAGAATTC-3′ and 5′-GGAACAACAAACATTGCCGTAG-3′ to amplify the 3′ half of the BCMV genome) and sequenced. To obtain the complete genome sequence, the 5′ and 3′ terminal sequences were analyzed by the 5′ and 3′ rapid amplification of cDNA ends (RACE) method as described previously (1). The assembled full-length sequence of BCMV isolated from C. tricuspidata was 10,051 nucleotides in length without a poly(A) tail. It was deposited in Genbank under the accession number KM076650. BCMV, a member of the genus Potyvirus, is one of the most common viruses naturally infecting legumes, including Phaseolus vulgaris (2). In general, BCMV is known to have a restricted host range outside legume species (2). Therefore, the identification of BCMV from C. tricuspidata in this report is very exceptional. Because BCMV is easily transmitted by various aphids like other potyviruses, a large-scale survey may be required for exact investigation of the BCMV incidence in C. tricuspidata to prevent rapid spread of the virus. To the best of our knowledge, this is the first report of BCMV in C. tricuspidata. References: (1) H.-R. Kwak et al. Plant Pathol. J. 29:274, 2013. (2) M. Saiz et al. Virus Res. 31:39, 1994. (3) S.-E. Schelhorn et al. PLoS Comput. Biol. 9:e1003228, 2013.

First report of fig mosaic virus infecting common fig (Ficus carica) in Japan

2012 ◽  
Vol 78 (2) ◽  
pp. 136-139 ◽  
Author(s):  
Kazuya Ishikawa ◽  
Kensaku Maejima ◽  
Susumu Nagashima ◽  
Nobuo Sawamura ◽  
Yusuke Takinami ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Ficus Carica ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

scholarly journals Identification and characterization of two novel genomic RNA segments of fig mosaic virus, RNA5 and RNA6

2012 ◽  
Vol 93 (7) ◽  
pp. 1612-1619 ◽  
Author(s):  
Kazuya Ishikawa ◽  
Kensaku Maejima ◽  
Ken Komatsu ◽  
Yugo Kitazawa ◽  
Masayoshi Hashimoto ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Rna Virus ◽  
Mosaic Disease ◽  
The Novel ◽  
Genomic Rna ◽  
Evolutionary Patterns ◽  
Rna Molecules ◽  
Fig Mosaic Virus ◽  
Identification And Characterization

Fig mosaic virus (FMV), a negative-strand RNA virus, is recognized as a causal agent of fig mosaic disease. We performed RT-PCR for 14 FMV isolates collected from symptomatic fig plants in Japan and Serbia using primers corresponding to the conserved 13 nt stretches found at the termini of FMV genomic segments. The resulting simultaneous amplification of all FMV genomic segments yielded four previously identified segments of FMV and two novel segments. These novel FMV genomic RNA segments were found in each of the 14 FMV isolates analysed. In Northern blot studies, both the sense and antisense strands of these novel RNA molecules accumulated in FMV-infected fig leaves but not in uninfected fig leaves, confirming that they replicate as FMV genomic segments. Sequence analysis showed that the novel RNA segments are similar, in their structural organization and molecular evolutionary patterns, to those of known FMV genomic RNA segments. Our findings thus indicate that these newly discovered RNA segments are previously unidentified FMV genomic segments, which we have designated RNA5 and RNA6.

scholarly journals First report of apple rubbery wood virus 1 in apple in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Guojun Hu ◽  
Yafeng Dong ◽  
Zunping Zhang ◽  
Xudong Fan ◽  
Fang Ren ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Virus ◽  
Rt Pcr ◽  
Apple Rootstocks ◽  
Apple Trees ◽  
Illumina Hiseq ◽  
First Report ◽  
Sequence Contigs ◽  
Apple Stem

More than 30 viral and subviral pathogens infect apple (Malus domestica, an important fruit crop in China) trees and rootstocks, posing a threat to its production. With advances in diagnostic technologies, new viruses including apple rubbery wood virus 1 (ARWV-1), apple rubbery wood virus 2 (ARWV-2), apple luteovirus 1 (ALV), and citrus virus A (CiVA) have been detected (Beatriz et al. 2018; Rott et al. 2018; Hu et al. 2021). ARWV-1 (family Phenuiviridae) is a negative-sense single-stranded RNA virus with three RNA segments (large [L], medium [M], and small [S]). It causes apple rubbery wood disease (Rott et al. 2018) and is found in apple rootstocks, causing leaf yellowing and mottle symptoms in Korea (Lim et al. 2018). To determine virus prevalence in apple trees in China, 200 apple leaf and shoot samples were collected from orchards in Hebei (n = 26), Liaoning (40), Shandong (100), Yunnan (25), and Shanxi (4), and Inner Mongolia (5) in 2020. Total RNA was extracted from the shoot phloem or leaf (Hu et al., 2015) and subjected to reverse transcription (RT)-PCR to detect apple chlorotic leaf spot virus (ACLSV), apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), apple necrotic mosaic virus (ApNMV), apple scar skin viroid (ASSVd), ARWV-2, ARWV-1, ALV, and CiVA, using primers specific to respective viruses (Supplementary Table 1). The prevalence of ACLSV, ASPV, ASGV, ApNMV, ASSVd, ARWV-2, ARWV-1, ALV and CiVA was found to be 75.5%, 85.5%, 86.0%, 43.0%, 4.0%, 48.5%, 10.5%, 0% and 0%, respectively (Supplementary Table 2). Among the 21 positive samples for ARWV-1, three, five and 13 samples were from Hebei, Liaoning, and Shandong, respectively. Five ARWV-1-positive samples (cultivars Xinhongjiangjun, Xiangfu-1, Xiangfu-2 and Tianhong) showed leaf mosaic symptoms. To confirm ARWV-1 by RT-PCR, amplicons from Xiangfu-1 and Tianhong were cloned into the pMD18-T vector (Takara, Dalian, China), and three clones of each sample were sequenced. BLASTn analyses demonstrated that the sequences (accession nos. MW507810–MW507811) shared 96.9%–98.9% identity with ARWV-1 sequences (MH714536, MF062127, and MF062138) in GenBank. An lncRNA library was prepared for high-throughput sequencing (HTS) with the Illumina HiSeq platform using Xiangfu-1 RNA. A total of 71,613,294 reads were obtained. De novo assembly of the reads revealed 135 viral sequence contigs of ACLSV, ASGV, ASPV, ApNMV, ARWV-1, and ARWV-2. The sequences of contig-100_88981 (302 nt) and contig-100_25701 (834 nt) (accession nos. MW507821 and MW507820) matched those of segment S from ARWV-1, whereas the sequences of contig-100_6542 (1,660 nt) and contig-100_27 (7,364 nt) (accession nos. MW507819 and MW507818) matched those of segments M and L, respectively. To confirm the HTS results, fragments of segments L (744 bp), M (747 bp), and S (554 bp) from Xiangfu-1 and Tianhong were amplified (Supplementary Table 1) and sequenced. The sequences (accession nos. MW507812–MW507817) showed 94.8%–99.9% nucleotide identity with the corresponding segments of ARWV-1. Co-infection of ARWV-1 with ApNMV and/or ARWV-2 was confirmed in 17/21 ARWV-1-positive samples. The prevalence of ARWV-1/ApNMV, ARWV-1/ARWV-2, and ARWV-1/ApNMV/ARWV-2 infections was 61.9%, 71.4%, and 52.4%, respectively. To our knowledge, this is the first report of ARWV-1 infecting apple trees in China. Further research is needed to determine whether and how ARWV-1 affects apple yield and quality.

scholarly journals First Report of Bhendi yellow vein mosaic virus Associated with Yellow Vein Mosaic of Okra (Abelmoschus esculentus) in Thailand

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
L. M. Lee ◽  
J. T. Wang ◽  
U. Duangsong ◽  
...  
Keyword(s):  
Southeast Asia ◽  
Mosaic Virus ◽  
Mosaic Disease ◽  
Yellow Vein ◽  
Abelmoschus Esculentus ◽  
Marketable Yield ◽  
Universal Primer ◽  
First Report ◽  
Conserved Sequence ◽  
Yellow Vein Mosaic Virus

A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5′-GCGAAGCTTAGATAACGCTCCTT-3′; WTHOK6FL-C: 5′-TCCAAGCTTTGAGTCTGCAACGT-3′), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5′-TCCAAGCTTTGAGTCTGCATCGT-3′). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

scholarly journals First report of bean common mosaic virus infecting heavenly bamboo (Nandina domestica) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiu Su ◽  
Xiang Zhou ◽  
Yuan Li ◽  
Liangjin Ma ◽  
Xiaofei Cheng ◽  
...  
Keyword(s):  
New England ◽  
Mosaic Virus ◽  
Small Rna ◽  
Phylogenetic Trees ◽  
Genomic Sequence ◽  
Bean Common Mosaic Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Plantago Asiatica

Heavenly bamboo (Nandina domestica) is an evergreen ornamental plant with worldwide distribution. In May 2018, seven out of twenty N. domestica plants showing virus-like symptoms, such as yellow mosaic and curling, were observed in Lin’an, Zhejiang province. To determine the causal agent, a small RNA library was constructed using the Small RNA v1.5 Sample Prep Kit (Illumina, San Diego, USA) with total RNA extracted from leaves of a symptomatic plant. The library was sequenced by the Solexa platform at BGI Genomics (Shenzhen, China). A total number of 21,071,675 high-quality reads of 17-28 nucleotides (nt) in length remained after trimming adapter sequences and quality control. Reads were assembled using Velvet 0.7.31 and Oases 0.2.07 with the k-mer value of 17 (Schulz et al. 2012). BlastN and BlastX search against the GenBank viral nonredundant sequence databases revealed fifty-six contigs homologous to bean common mosaic virus (BCMV; genus Potyvirus; family Potyviridae). No contig homologous to the genomic sequence of other plant-infecting viruses was identified. These contigs were further assembled into a 9,315-nt fragment by SeqMan Pro 7.1.0 in Lasergene package (DNASTAR, Madison, WI), which covered 92.68% of the genome of BCMV strain CT (BCMV-CT; GenBank accession no. KM076650). The genome of this BCMV isolate (BCMV-NTZ1) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using primers designed based on assembled contigs with the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beijing, China) and the FirstChoice® RLM-RACE Kit (Invitrogen, Carlsbad, USA), respectively. Amplicons were cloned and Sanger sequenced with three independent clones per amplicon. The genome is 10,052 nt in length excluding the poly-A tail (Genbank accession no. MZ670770) and shared the highest nt sequence identities with BCMV-CT (88.46%). The putative polyprotein shared 93.36% amino acid (aa) sequence identity with that of BCMV-CT. BCMV-NTZ1 also clustered with BCMV-CT in phylogenetic trees based on BCMV full genomes and aa sequences of coat protein. Five-leaf-stage seedlings of Nicotiana tabacum, N. benthamiana, Glycine max (Linn.) Merr., and Capsicum frutescens were mechanically inoculated with sap of BCMV-infected N. domestica leaves at fifteen plants per species. Seedlings of G. max developed virus-like (mosaic and leaf deformity) symptoms (7/15) at 15 days post-inoculation, while other plants remained symptomless throughout the experiment. Subsequent RT-PCR on all the plants using primers 27F1/14Rter and sequencing confirmed the presence and absence of BCMV-NTZ1 in all symptomatic G. max seedlings and other asymptomatic indicator plants, respectively. Subsequent RT-PCR survey further confirmed the association of BCMV with symptomatic heavenly bamboo samples but not asymptomatic plants (7/20). To the best of our knowledge, this is the first report of BCMV naturally infecting heavenly bamboo in China. N. domestica is susceptible to many viruses, e.g., cucumber mosaic virus, plantago asiatica mosaic virus, nandina stem pitting virus, apple stem grooving virus, and alternanthera mosaic virus (Barnett et al. 1973; Ahmed et al. 1983; Hughes et al. 2002, 2005; Tang et al. 2010; Wei et al. 2015). Our results indicate that N. domestica can also serve as an overwinter reservoir for BCMV and special attention should be paid to the damage it may cause.

Sign in / Sign up

Export Citation Format

Share Document