scholarly journals First report of bean common mosaic virus infecting heavenly bamboo (Nandina domestica) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Xiu Su ◽  
Xiang Zhou ◽  
Yuan Li ◽  
Liangjin Ma ◽  
Xiaofei Cheng ◽  
...  
Keyword(s):  
New England ◽  
Mosaic Virus ◽  
Small Rna ◽  
Phylogenetic Trees ◽  
Genomic Sequence ◽  
Bean Common Mosaic Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Plantago Asiatica

Heavenly bamboo (Nandina domestica) is an evergreen ornamental plant with worldwide distribution. In May 2018, seven out of twenty N. domestica plants showing virus-like symptoms, such as yellow mosaic and curling, were observed in Lin’an, Zhejiang province. To determine the causal agent, a small RNA library was constructed using the Small RNA v1.5 Sample Prep Kit (Illumina, San Diego, USA) with total RNA extracted from leaves of a symptomatic plant. The library was sequenced by the Solexa platform at BGI Genomics (Shenzhen, China). A total number of 21,071,675 high-quality reads of 17-28 nucleotides (nt) in length remained after trimming adapter sequences and quality control. Reads were assembled using Velvet 0.7.31 and Oases 0.2.07 with the k-mer value of 17 (Schulz et al. 2012). BlastN and BlastX search against the GenBank viral nonredundant sequence databases revealed fifty-six contigs homologous to bean common mosaic virus (BCMV; genus Potyvirus; family Potyviridae). No contig homologous to the genomic sequence of other plant-infecting viruses was identified. These contigs were further assembled into a 9,315-nt fragment by SeqMan Pro 7.1.0 in Lasergene package (DNASTAR, Madison, WI), which covered 92.68% of the genome of BCMV strain CT (BCMV-CT; GenBank accession no. KM076650). The genome of this BCMV isolate (BCMV-NTZ1) was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using primers designed based on assembled contigs with the Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beijing, China) and the FirstChoice® RLM-RACE Kit (Invitrogen, Carlsbad, USA), respectively. Amplicons were cloned and Sanger sequenced with three independent clones per amplicon. The genome is 10,052 nt in length excluding the poly-A tail (Genbank accession no. MZ670770) and shared the highest nt sequence identities with BCMV-CT (88.46%). The putative polyprotein shared 93.36% amino acid (aa) sequence identity with that of BCMV-CT. BCMV-NTZ1 also clustered with BCMV-CT in phylogenetic trees based on BCMV full genomes and aa sequences of coat protein. Five-leaf-stage seedlings of Nicotiana tabacum, N. benthamiana, Glycine max (Linn.) Merr., and Capsicum frutescens were mechanically inoculated with sap of BCMV-infected N. domestica leaves at fifteen plants per species. Seedlings of G. max developed virus-like (mosaic and leaf deformity) symptoms (7/15) at 15 days post-inoculation, while other plants remained symptomless throughout the experiment. Subsequent RT-PCR on all the plants using primers 27F1/14Rter and sequencing confirmed the presence and absence of BCMV-NTZ1 in all symptomatic G. max seedlings and other asymptomatic indicator plants, respectively. Subsequent RT-PCR survey further confirmed the association of BCMV with symptomatic heavenly bamboo samples but not asymptomatic plants (7/20). To the best of our knowledge, this is the first report of BCMV naturally infecting heavenly bamboo in China. N. domestica is susceptible to many viruses, e.g., cucumber mosaic virus, plantago asiatica mosaic virus, nandina stem pitting virus, apple stem grooving virus, and alternanthera mosaic virus (Barnett et al. 1973; Ahmed et al. 1983; Hughes et al. 2002, 2005; Tang et al. 2010; Wei et al. 2015). Our results indicate that N. domestica can also serve as an overwinter reservoir for BCMV and special attention should be paid to the damage it may cause.

scholarly journals First Report of Cucumber mosaic virus Associated with Capsicum chinense var. Scotch Bonnet in Florida

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1016-1016 ◽  
Author(s):  
B. Babu ◽  
H. Dankers ◽  
M. L. Paret
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Yellow Mosaic Virus ◽  
Hot Pepper ◽  
Crystalline Inclusion ◽  
Post Inoculation ◽  
Capsicum Chinense ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Assays

Scotch bonnet (Capsicum chinense) is a tropical hot pepper variety that is grown in South America, the Caribbean Islands, and in Florida, and is an important cash crop. In Florida, scotch bonnet is grown on ~100 acres annually. Virus-like leaf symptoms including mosaic and yellow mottling were observed on scotch bonnet plants in a field at Quincy, FL, with a disease incidence of ~5%. Two symptomatic and one non-symptomatic plant sample were collected from this field for identification of the causal agent associated with the symptoms. Viral inclusion assays (2) of the epidermal tissues of the symptomatic scotch bonnet samples using Azure A stain indicated the presence of spherical aggregates of crystalline inclusion bodies. Testing of the symptomatic samples using lateral flow immunoassays (Immunostrips, Agdia, Elkhart, IN) specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Pepper mild mottle virus (PMMoV), Tobacco mosaic virus (TMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV), showed a positive reaction only to CMV. The sap from an infected leaf sample ground in 0.01 M Sorensons phosphate buffer (pH 7.0) was used to mechanically inoculate one healthy scotch bonnet plant (tested negative for CMV with Immunostrip) at the 2- to 3-leaf stage. The inoculated plant developed mild mosaic and mottling symptoms 12 to 14 days post inoculation. The presence of CMV in the mechanically inoculated plant was further verified using CMV Immunostrips. Total RNA was extracted (RNeasy Plant Mini Kit, Qiagen, Valencia, CA) from the previously collected two symptomatic and one non-symptomatic scotch bonnet samples. The samples were subjected to reverse-transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, Grand Island, NY), and using multiplex RT-PCR primer sets (1). The primers were designed to differentiate the CMV subgroup I and II, targeting the partial coat protein gene and the 3′UTR. The RT-PCR assays using the multiplex primers produced an amplicon of 590 bp, with the CMV subgroup I primers. The RT-PCR product was only amplified from the symptomatic leaf samples. The obtained amplicons were gel eluted, and directly sequenced bi-directionally (GenBank Accession Nos. KF805389 and KF805390). BLAST analysis of these sequences showed 97 to 98% nucleotide identities with the CMV isolates in the NCBI database. The isolates collected in Florida exhibited highest identity (98%) with the CMV isolate from tomato (DQ302718). These results revealed the association of CMV subgroup I with symptomatic scotch bonnet leaf samples. Although CMV has been reported from scotch bonnet, this is the first report of its occurrence in Florida. References: (1) S. Chen et al. Acta Biochim Biophys Sin. 43:465, 2011. (2) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986.

scholarly journals First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
S. Lim ◽  
Y.-H. Lee ◽  
D. Igori ◽  
F. Zhao ◽  
R. H. Yoo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
South Korea ◽  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Nucleotide Sequences ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

scholarly journals First Report of the Natural Infection of Robinia pseudoacacia with Alfalfa mosaic virus

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 851-851 ◽  
Author(s):  
G. Delibašić ◽  
B. Tanović ◽  
J. Hrustic ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Black Locust ◽  
Natural Infection ◽  
Robinia Pseudoacacia ◽  
Alfalfa Mosaic Virus ◽  
Natural Host ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Negative Controls

Robinia pseudoacacia L. (family Fabaceae), commonly known as black locust, is native to the southeastern United States, but has been widely planted and naturalized in temperate regions worldwide. In Europe it is often planted alongside streets and in parks, not only because of the dense canopy and impressive flower clusters in spring, but also because it tolerates air pollution well. In June 2012, several black locust trees exhibiting yellow leaf spots accompanied by mottling and leaf deformation were observed in a park in Backa Topola, North Backa District, Serbia. Numerous aphid colonies were found colonizing symptomatic trees. Leaves collected from nine symptomatic and 10 asymptomatic trees were tested for the presence of three common aphid-transmitted viruses, Alfalfa mosaic virus (AMV), Cucumber mosaic virus, and Potato virus Y, using double-antibody sandwich (DAS)-ELISA with commercial polyclonal antibody (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy black locust leaves were included in each assay. AMV was serologically detected in all symptomatic and also in four of the asymptomatic trees, while no other tested viruses were found. Sap from affected leaves of a ELISA-positive sample (373-12) was mechanically inoculated onto five plants each of Chenopodium quinoa and Nicotiana benthamiana using 0.01 M phosphate buffer (pH 7). Symptoms including local chlorotic leaf lesions followed by mosaic on C. quinoa and a bright yellow mosaic on N. benthamiana were observed on all inoculated plants 5 and 10 days post-inoculation, respectively. The identity of the virus was confirmed using reverse transcription (RT)-PCR analysis. Total RNAs from all naturally and mechanically infected plants were isolated using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was carried out using the One-Step RT-PCR Kit (Qiagen) with primer pair CP AMV1 and CP AMV2 specific to the partial CP gene and 3′-UTR of AMV RNA 3 (1). Total RNAs from Serbian AMV isolate from alfalfa (GenBank Accession No. FJ527748) and RNA extract from healthy leaves of R. pseudoacacia were used as positive and negative controls, respectively. All tested plants, as well as the positive control, yielded an amplicon of the correct predicted size (751 bp), while no amplicon was recorded in the healthy control. The amplified product of isolate 373-12 was purified with QIAquick PCR Purification Kit (Qiagen) and sequenced on ABI PRISM 3700 DNA analyzer (Macrogen, South Korea) in both directions (KC288155). Pairwise comparison of the 373-12 isolate CP sequence with those available in GenBank, conducted with MEGA5 software (4), revealed the maximum nucleotide identity of 99% (99% amino acid identity) with the soybean isolate (HQ185569) from Tennessee. AMV has a worldwide distribution and its natural host range includes over 150 plant species, including many herbaceous and several woody plants (2). To our knowledge, this is the first report of R. pseudoacacia as a natural host of AMV worldwide. This finding has potentially significant implications for the successful production of susceptible crops, considering that black locust could act as an important link in the epidemiology of AMV as it may serve as a virus reservoir (3). References: (1) M. M. Finetti-Sialer et al. J. Plant Pathol. 79:115, 1997. (2) R. Hull. Comparative Plant Virology. 2nd ed. Elsevier Academic Press, Burlington, MA, 2009. (3) E. E. Muller et al. Plant Dis. 96:506, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

scholarly journals First Report of Cucumber mosaic virus in Taro Plants in China

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 574-574 ◽  
Author(s):  
Y. F. Wang ◽  
G. P. Wang ◽  
L. P. Wang ◽  
N. Hong
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Central China ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Cmv Infection ◽  
First Report ◽  
Cp Gene ◽  
Two Samples ◽  
Pcr Products

Taro (Colocasia esculenta L. Schott) is an important crop worldwide. In China, the growing area and productivity of taro increased greatly in recent years. During the 2010 to 2013 growing seasons (from May to July), the incidence of Cucumber mosaic virus (CMV) in taro was determined. Leaf samples from 91 taro plants, including 26 plants of cv. Hongyayu grown in Jiangxi Province in eastern China, 33 plants of cv. Eyu no.1 grown in Hubei Province in central China, and 32 plants of cv. Baiyu grown in Guangxi Province in southwest China were collected randomly and tested for the presence of CMV by reverse transcription (RT)-PCR. Some sampled plants of cv. Hongyayu and Eyu no.1 showed leaf chlorosis or chlorotic spots, and most of the plants of these three cultivars showed feather-like mosaic symptom on their leaves, which was confirmed to be associated with the infection of Dasheen mosaic virus (DsMV) in our previous studies (3). Total RNA was extracted from leaves using CTAB protocol reported by Li et al. (1). Primer set forward 5′-ATGGACAAATCTGAATCAACC-3′/reverse 5′-TAAGCTGGATGGACAACCCGT-3′ (4) was used for the amplification of a 777-bp fragment, which contains the complete capsid protein (CP) gene of 657 bp. PCR products of the expected size were identified from 11 taro samples, including two samples of Hongyayu, three Eyu no.1, and six Baiyu plants. The result did not show any specific association between the symptoms observed and CMV infection. The obtained PCR products were cloned individually into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones derived from each product were sequenced by Genscript Corp., Nanjing, China. Pairwise comparison of CP gene sequences (Accession No. of one representation CP sequence: KF564789) showed 99.7 to 99.8% nucleotide (nt) and 99.1 to 99.5% deduced amino acid (aa) sequence identity among themselves, and 92.0 to 94.3% and 76.5 to 77.7% nt identities with corresponding sequences of CMV isolates in subgroup I and subgroup II (2), respectively. The maximum likelihood phylogenetic trees of nt and aa sequences generated by Clustal X v1.8 revealed that all these CMV isolates from taro in China fell into subgroup I. To further confirm the CMV infection, leaf saps of CMV infected taro plants of cv. Eyu no.1 were mechanically inoculated onto Pinellia ternate and Cucumis sativus. Plants of P. ternate showed local chlorotic lesions on the inoculated leaves and downward curl of newly grown leaves, and C. sativus showed local chlorotic lesions on the inoculated leaves and crinkle of newly grown leaves at 10 to 15 days post inoculation. The RT-PCR detection confirmed the CMV infection in those inoculated plants, and that the plants of P. ternate were also positive to DsMV, further complementing the results obtained above. To our knowledge, this is the first report of CMV occurrence in taro plants grown in China. Our results indicated that taro plants were widely infected by CMV isolates in subgroup I. This study provides important information for further evaluating the viral sanitary status of taro germplasm and improving the certification program of taro propagation materials in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) P. Palukaitis et al. Adv. Virus. Res. 62:241, 2003. (3) S. M. Shi et al. Acta Hortic. Sin. 39:509, 2012. (4) P. D. Xu et al. Chinese J. Virol. 15:164, 1999.

scholarly journals First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
B. E. González-Pacheco ◽  
L. Silva-Rosales
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
True Leaf ◽  
Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

scholarly journals First Report of Bean common mosaic virus Infecting Lablab purpureus in India

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 881-881 ◽  
Author(s):  
A. C. Udayashankar ◽  
S. Chandra Nayaka ◽  
S. R. Niranjana ◽  
O. S. Lund ◽  
H. S. Prakash
Keyword(s):  
Coat Protein ◽  
Mosaic Virus ◽  
Yield Loss ◽  
Bean Common Mosaic Virus ◽  
Lablab Purpureus ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Degenerate Primers ◽  
First Report ◽  
Field Samples

Lablab bean (Lablab purpureus L. Sweet) is a widely cultivated, highly drought tolerant legume vegetable crop grown in diverse environmental conditions worldwide. In India and elsewhere, the young pods are consumed as a fresh vegetable and mature dry seeds are important in the diet of people preferring vegetarian food (2). Small-holding farmers use their own saved seeds for sowing. During October 2008, L. purpureus exhibiting symptoms of stunting, mosaic, vein-banding, vein-clearing, mottling, and blisters suggestive of a viral infection were observed in and around the Mysore District of Karnataka State, India. Incidence of the disease ranged from 1 to 10% in different fields. Symptomatic leaves were collected from fields of Daripura Village, Mysore District, Karnataka. Viruses that were tested by indirect ELISA included Cucumber mosaic virus, Tobacco mosaic virus, Cowpea aphid-borne mosaic virus, Cowpea mosaic virus, Cowpea mottle virus, Southern bean mosaic virus, and Bean common mosaic virus (BCMV). Results of the ELISA tests indicated that all 28 samples collected from different fields were infected with BCMV. Examination of tissue sap from symptomatic plants by electron microscopy revealed flexuous rod-shaped particles (~750 nm long). An immunocapture-reverse transcription (IC-RT)-PCR assay employing degenerate primers for amplifying partial coat protein (CP) and 3′-UTR of potyviruses (1) yielded a ~700-bp product that was cloned and sequenced (GenBank Accession No. HM776637). Sequence identity at the nucleotide level was 96% with BCMV strain NL-7n (GenBank Accession No. GQ456169) infecting common bean from Himachal Pradesh, India. RTPCR was performed with a virus-specific primer pair (FW3-5′-GCAGTAGCACAGATGAAGGCA-3′: Rv3-5′-GGTTCTTCCGGCTTACTCATAAACAT-3′) designed to amplify 340 bp, the partial coat protein gene of BCMV. All symptomatic L. purpureus field samples and screenhouse-grown seedlings manually inoculated with infected sap were positive for BCMV infection in RT-PCR assay employing specific primers with amplification of a 340-bp product. To our knowledge, this is the first report of BCMV infecting L. purpureus in India. BCMV has also been reported in L. purpureus in Uganda (4) and Nigeria (3). Plants that were confirmed by ELISA to be infected were tagged, and from these plants, seeds were collected and pooled. Four hundred seeds were germinated and a rate of 6.5% seed transmission was determined based on symptoms, ELISA, and PCR. From December 2008 to December 2010, different L. purpureus plantings were monitored for BCMV incidence. Plants infected at different growth stages were tagged and pods were harvested from infected and healthy plants. Data from at least 100 BCMV-infected L. purpureus plants from each of 12 different fields were recorded for yield loss analysis. In terms of number of pods per plant, number of seeds per pod, and seed weight, an average as much as 40% yield loss was recorded from 12 different fields. Because seeds collected from these plants are used for subsequent plantings, these plants may act as virus reservoirs or foci of infection. References: (1) A. S. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) M. N. Maruthi et al. Ann. Appl. Biol. 149:187, 2006. (3) O. O. Odedara et al. J. Gen. Virol. 74:322, 2008. (4) T. N. Sengooba et al. Plant Pathol. 46:95, 1997.

scholarly journals First Report of Watermelon mosaic virus Infecting Melon and Watermelon in Bosnia and Herzegovina

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1749-1749 ◽  
Author(s):  
V. Trkulja ◽  
J. Vasić ◽  
B. Vuković ◽  
I. Stanković ◽  
A. Vučurović ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Bosnia And Herzegovina ◽  
Citrullus Lanatus ◽  
Economic Losses ◽  
Watermelon Mosaic Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Leaf Deformation ◽  
Negative Controls

Hereby the expansion of host range of Watermelon mosaic virus (WMV, Potyvirus, Potyviridae), found previously on zucchini in Bosnia and Herzegovina (3), to two new hosts is reported. Also, this is the first finding of WMV “emerging” (EM) isolate causing more severe symptoms in some cucurbits than “classic” (CL) isolates (1). During a July 2013 survey to determine the presence of WMV on cucurbits in Bosnia and Herzegovina, in the Kosijerovo locality (Laktaši Municipality, Bosnia and Herzegovina), virus-like symptoms were observed on 10% of plants. Severe mosaic, puckering, and leaf deformation as well as necrosis and leaf distortion were observed in a melon (Cucumis melo L.) crop, while mosaic, green vein banding, and leaf curling with reduced leaf size were observed in watermelon (Citrullus lanatus [Thunb.] Matsum and Nakai). Sampled melon and watermelon plants were tested for the presence of WMV with commercial double-antibody sandwich (DAS)-ELISA kit (Bioreba, AG, Reinach, Switzerland). Commercial positive and negative controls were included in each assay. Out of the 30 melon and 25 watermelon plants tested, 24 and 23 samples were positive for WMV, respectively, while no other cucurbit viruses were detected. The virus was mechanically transmitted from one of each of ELISA-positive melon (309-13) and watermelon (314-13) samples to five plants of each Cucurbita pepo ‘Ezra F1’, C. melo ‘Ananas,’ and C. lanatus ‘Creamson sweet’ using 0.01 M phosphate buffer (pH 7). Mild to severe mosaic and bubbling followed by leaf deformation were observed in all inoculated plants 10 to 14 days post-inoculation, regardless the isolate. Serological detection was verified with reverse transcription (RT)-PCR using the One-Step RT-PCR Kit (Qiagen, Hilden, Germany) with primers WMV 5′ and WMV 3′ (1), designed to amplify a 402- to 408-bp fragment overlapping the N-terminal part of the coat protein (CP) gene. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen). Total RNAs from the Serbian WMV oil pumpkin isolate (GenBank Accession No. JF325890) and RNA from healthy melon and watermelon plants were used as positive and negative controls, respectively. An amplicon of the expected size was produced from all serologically positive melon and watermelon plants, but not from healthy tissues. The RT-PCR products derived from isolates 309-13 and 314-13 were sequenced directly (KJ603311 and KM212956, respectively) and compared with WMV sequences available in GenBank. Sequence analysis revealed 91.5% nucleotide (nt) identity (94.6% amino acid [aa] identity) between the two WMV isolates. The melon WMV isolate shared the highest nt identity of 100% with four WMV isolates from Slovakia (GQ241712 to 13), Serbia (FJ325890), and Bosnia and Herzegovina (KF517099), while the sequence of isolate 314-13 had the highest nt identity with three Serbian isolates (JX262104 to 05 and JX262114) of 99.7% (99.2% aa identity). Phylogenetic analyses placed isolate 309-13 with CL isolates, while isolate 314-13 clustered with EM isolates (1,2). To our knowledge, this is the first report of WMV on melon and watermelon and the first report on EM isolates in Bosnia and Herzegovina. This could cause significant economic losses and become a limiting factor for cucurbit production with the potential of EM isolates to rapidly replace CL (2). References: (1) C. Desbiez et al. Arch. Virol. 152:775, 2007. (2) C. Desbiez et al. Virus Res. 152:775, 2009. (3) V. Trkulja et al. Plant Dis. 98:573, 2014.

scholarly journals First Report of Bean common mosaic virus Infecting Mungbean (Vigna radiata) in China

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
X. Y. Cui ◽  
L. Shen ◽  
X. X. Yuan ◽  
H. P. Gu ◽  
X. Chen
Keyword(s):  
Mosaic Virus ◽  
Vigna Radiata ◽  
Phylogenetic Trees ◽  
Bean Common Mosaic Virus ◽  
Mosaic Disease ◽  
Total Rna ◽  
First Report ◽  
Cp Gene ◽  
Peanut Stripe Virus ◽  
Wide Range

Bean common mosaic virus (BCMV) is a member of the genus Potyvirus and one of the numerous viruses that can infect Phaseolus vulgaris. In May of 2013, we planted more than 100 varieties of mungbean in fields and a greenhouse of Nanjing. Mungbean (Vigna radiata (Linn.) Wilczek.) with leaves displaying mosaic and shrinkage typical of viral infection was observed in a greenhouse and a field in Nanjing. About 60% of the varieties can be infected. The symptoms in some sources from Southeast Asian countries and wild germplasm are heavier, while the symptoms are lighter on the local varieties. It can be transmitted to mungbean via aphid or mechanical inoculation, or by seeds. The infected leaves were collected for electron micrograph analysis. Pinwheel inclusion and filamentous virus particles were observed, indicating a Potyvirus infection. To confirm the presence of Potyvirus infection, total RNA was extracted from plants from the greenhouse and field, and RT-PCR was performed using universal Potyvirus primers (Sprimer (+) 5′-GGXAAYAAYAGYGGXCAZCC-3′; X=A, G, C or T, Y=T or C, Z=A or G); M4T (5′-GTTTTCCCAGTCACGAC(T)-3′), which amplify a region of the 3′ fragment of the RNA-dependent RNA polymerase of potyviruses (1). The 596-bp sequence was found to be 95% identical to the BCMV isolate HB (GenBank Accession No. KC478389.1). To confirm the presence of BCMV, three leaf samples were randomly collected and all were determined to be positive when subjected to ELISA using BCMV-specific antibodies. The virus infecting mungbean was identified as BCMV and the strain was named BCMV-JAAS (KJ866945). Using gene-specific primers (BCMV-cp-F: 5′-CAAAAGGACAAGGATTGAGGA, BCMV-cp-R: 3′-ACAACAAACATTGCCGTAGC) for the reported coat protein gene in BCMV, a 1,080-bp gene fragment was amplified from the total RNA of the isolate, and subsequent sequence analysis indicated that an 862-bp region contained the complete cp gene that encodes a 228 amino acid protein. The nucleotide sequences of the cp gene from the isolate shared 96% homology with the reported BCMV-HB. The phylogenetic trees based on the CP gene show that BCMV-JAAS (KJ866945) was most closely related to other Chinese BCMV isolates (KF439722.1 and AJ132145.1) followed by Azuki mosaic virus (AB012663.1) and Peanut stripe virus (U34972.1). These results indicate that the virus associated with the mosaic disease in mungbean is an isolate of BCMV. To our knowledge, this is the first report of BCMV infecting mungbean in China. BCMV affects a wide range of legume crops and can spread rapidly, causing serious harm. The discovery could effectively control BCMV and characterize the prevalent BCMV strains. Research utilizing whole-genome sequencing of the mungbean isolate is continuing and is currently being expanded to characterize the genetic diversity of the virus, assisting in the study of the evolution of the virus. Reference: (1) J. Chen and J. P. Chen. Chin. J. Virol. 18:372, 2002.

scholarly journals First Report of Dasheen Mosaic Virus Infecting Typhonium giganteum Engl. (Baifuzi) in Henan Province of China

Plant Disease ◽  
2021 ◽  
Author(s):  
YanHong Qin ◽  
Suxia Gao ◽  
Yuxia Liu ◽  
Yi Wen ◽  
Chuantao Lu ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Throughput Sequencing ◽  
Genomic Sequence ◽  
Close Association ◽  
Henan Province ◽  
Full Length ◽  
Reference Sequence ◽  
Rt Pcr ◽  
First Report ◽  
Beijing China

Typhonium giganteum Engl. (Baifuzi ) is a perennial plant of the family Araceae. In China, its root is commonly used as an antispasmodic for stroke and cancer treatment (Chi et al. 2010; Gao et al. 2014; Khalivulla et al. 2019). Yuzhou city in Henan Province is the main producing area of T. giganteum Engl., and in July 2020, a survey of viral disease infecting T. giganteum Engl. was conducted in the city. In the surveyed fields (n =5), over 60% of plants displayed varying levels of virus-like symptoms, including mosaic, chlorotic and leaf distortion (Supplementary Figure S1) . To identify possible viral pathogens associated with the disease symptoms afflicting T. giganteum Engl., one leaf each from 25 symptomatic plants was collected and analyzed by high-throughput sequencing (HTS) as well as PCR. For HTS analysis, total RNA was extracted from one pooled sample containing a portion of all abovementioned leaves using RNAprep Pure Plant Plus Kit (TIANGEN Biotech, Beijing, China). After removing ribosomal RNA with Ribo-off rRNA depletion kit (Vazyme Biotech, Nanjing, China), a sequencing library was generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) and sequenced on an Illumina Novaseq6000 sequencing system at Berry Genomics Corporation (Beijing, China). A total of 6,899,143 high-quality clean reads were obtained after trimming and used for contig assembly. BLASTn and BLASTx analyses on the contigs (n = 128,400) showed that one contig (9,245 bp in length) exhibited a sequence identity of 84.0% with the reference sequence of dasheen mosaic virus (DsMV, NCBI reference seq. NC_003537, genus Potyvirus, family Potyviridae) , suggesting infection of the plants by DsMV. No other viral sequences were detected in the sample. To confirm these results, a near full-length genomic sequence of DsMV was obtained from one sample (sample no. 39) by reverse transcription polymerase chain reaction (RT-PCR) of three overlapping fragments with the following primer pairs: DsMV-1F (5′-AAATTAAAACATCTCAACAAAACCTACA-3′) /DsMV-4130R (5′-TTCATGGTCCTCGTGGAGTATA-3′), DsMV-3870F (5′-GAGGACGTGAGAATTCAAAGTCT-3′)/DsMV-8250R (5′-GTCCAACCTTGCTTGATGCATGC-3′), DsMV-7690F (5′-GGAGCGACTCCTCTTCCAAAGTTGTG-3′)/DsMV-10100R (5′-TGAACACCGTGCACGAAGCATCTC-3′). The PCR products were cloned into pMD19-T vector (TAKARA Biotech, Dalian, China) and sequenced. The near full-length genomic sequence of the isolate (DsMV-BF39) was 9,737 nt in length and deposited into GenBank under the accession no. MZ043618. BLASTn analysis of this sequence demonstrated that it shared an identity ranging from 78.6% (MG602234) to 85.6% (MG602227) with various DsMV isolates. To determine whether DsMV was closely associated with the symptoms observed in T. giganteum Engl., leaf tissues from 30 symptomatic plants and 22 asymptomatic plants were analyzed by RT-PCR using primer pairs DsMV-CPF (5′-TGTTCTGTGAACATGATGAAGTTG-3′, sense) and DsMV-CPR (5′-GTAACTGTGGCCTGTTTACCAG-3′, antisense) targeting a 916 bp fragment of the CP gene of DsMV. Amplicons with the expected size were detected from the 30 symptomatic plants but not from the 22 asymptomatic plants, suggesting a close association between DsMV infection and the observed symptoms. To our knowledge, this is the first report of DsMV infecting T. giganteum Engl.. Further study is needed to identify the specific symptoms induced by this virus in T. giganteum Engl. and to understand the biological characteristics, epidemiology, prevalence of this virus in China.

scholarly journals First Report of Alfalfa mosaic virus Infecting Lavandula × intermedia in Croatia

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1002-1002 ◽  
Author(s):  
K. Vrandečić ◽  
D. Jurković ◽  
J. Ćosić ◽  
I. Stanković ◽  
A. Vučurović ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Alfalfa Mosaic Virus ◽  
Limiting Factor ◽  
Post Inoculation ◽  
Rt Pcr ◽  
Pcr Assay ◽  
First Report ◽  
Bright Yellow ◽  
Das Elisa

Lavandin (Lavandula × intermedia Emeric ex Loiseleur) is cultivated on a large scale in some South European countries for the extraction of essential oils or as an ornamental plant for gardens and landscapes. In May of 2012, virus-like symptoms including bright yellow calico mosaic, leaf distortion, and growth reduction were observed on 15% of lavandin plants in a commercial nursery in Banovo Brdo locality, Baranja County, Republic of Croatia. Leaves from 15 symptomatic lavandin plants were collected and examined by double-antibody sandwich (DAS)-ELISA using commercial antisera (Bioreba AG, Reinach, Switzerland) against two viruses known to infect Lavandula spp.: Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV) (2,3). Commercial positive and negative controls and extracts from healthy lavandin leaves were included in each ELISA. Only AMV was detected serologically in all 15 tested samples. Five plants each of Chenopodium quinoa, C. amaranticolor, and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (70-12) using 0.01 M phosphate buffer (pH 7). Local chlorotic spots accompanied by systemic mosaic on both Chenopodium species and bright yellow mosaic on N. benthamiana were observed 6 and 12 days post-inoculation, respectively. Test plants were assayed by DAS-ELISA and all inoculated plants of each species tested positive for AMV. The presence of AMV in all symptomatic lavandin plants was further confirmed by reverse transcription (RT)-PCR assay. Total nucleic acid was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) using AMV specific primer pair CP AMV1 (5′-TCCATCATGAGTTCTTCAC-3′) and CP AMV2 (5′-AGGACTTCATACCTTGACC-3′) (1). Total RNAs obtained from the Serbian AMV isolate from alfalfa (GenBank Accession No. FJ527748) and healthy L. × intermedia plant served as the positive and negative control, respectively. The 751-bp amplicons, covering the partial coat protein (CP) gene and 3′-UTR, were obtained from all 15 samples that were serologically positive to AMV as well as from positive control. No amplification product was observed when extract from healthy L. × intermedia plant was used as template in the RT-PCR assay. The RT-PCR product derived from isolate 70-12 was directly sequenced in both directions using the same primer pair as in RT-PCR and deposited in GenBank (JX996119). Multiple sequence alignment of the CP open reading frame was performed by MEGA5 software (4) and revealed that the isolate 70-12 showed the highest nucleotide identity of 99.4% (99.5% amino acid identity) with Serbian AMV isolate from tobacco (FJ527749). To our knowledge, this is the first report of AMV on L. × intermedia in Croatia. Because lavandin is an aromatic plant traditionally and widely grown in Croatia, the presence of AMV could be a limiting factor for its successful production. References: (1) M. M. Finetti-Sialer et al. J. Plant Pathol. 79:115, 1997. (2) T. Kobylko et al. Plant Dis. 92:978, 2008. (3) L. Martínez-Priego et al. Plant Dis. 88:908, 2004. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

Sign in / Sign up

Export Citation Format

Share Document