Total RNA Extraction from Saccharomyces cerevisiae Using Hot Acid Phenol

Isolation of RNA from yeast is complicated by the need to first break the thick, rigid cell wall. The protocol provided here uses a cycle of heating and freezing of cells in the presence of phenol and the detergent sodium dodecyl sulfate (SDS). The extraction is performed in the presence of low salt so that, following separation of the aqueous and phenol phases by centrifugation, DNA can be collected from the interface while RNA remains in the aqueous phase. This protocol should yield ∼50–250 µg of RNA from 10 mL of culture. The RNA isolated using this approach is suitable for most follow-up applications such as northern blot hybridization, reverse transcriptase-polymerase chain reaction (RT-PCR), and cDNA construction.

Complete Sequence, Genome Organization and Molecular Detection of Grapevine Line Pattern Virus, a New Putative Anulavirus Infecting Grapevine

Grapevine line pattern virus (GLPV) was first described 30 years ago in Hungary. The lack of its genomic sequences and of an available antiserum made its detection impossible in other parts of the world. Three different high-throughput sequencing (HTS) protocols applied on a GLPV-infected vine allowed the construction of the full genome sequence of this virus. It includes three RNA segments, encoding four proteins: methyltransferase-helicase (1a), RNA-dependent RNA polymerase (2a), movement protein (3a) and coat protein (3b). The obtained sequences were used to design specific primers for its detection by RT-PCR and Northern blot hybridization, respectively. These diagnostic methods were used to test the presence of GLPV in graft-inoculated plants and in 220 grapevine accessions of different Mediterranean origins. The three RNAs-encoding proteins of GLPV shared a very high amino acid identity with those of hop yellow virus, a tentative member of the Anulavirus genus, leaving no doubt that both are two isolates of the same viral species. A circular RNA originating from the RNA2 was found, for which an alternative silencing suppressor role is hypothesized. Further investigation is needed to determine this possibility and also the host range and pathological significance of the virus.

Transgenic Wheat Harboring an RNAi Element Confers Dual Resistance Against Synergistically Interacting Wheat Streak Mosaic Virus and Triticum Mosaic Virus

Wheat streak mosaic virus (WSMV) and triticum mosaic virus (TriMV) are economically important viruses of wheat (Triticum aestivum L.), causing significant yield losses in the Great Plains region of the United States. These two viruses are transmitted by wheat curl mites, which often leads to mixed infections with synergistic interaction in grower fields that exacerbates yield losses. Development of dual-resistant wheat lines would provide effective control of these two viruses. In this study, a genetic resistance strategy employing an RNA interference (RNAi) approach was implemented by assembling a hairpin element composed of a 202-bp (404-bp in total) stem sequence of the NIb (replicase) gene from each of WSMV and TriMV in tandem and of an intron sequence in the loop. The derived RNAi element was cloned into a binary vector and was used to transform spring wheat genotype CB037. Phenotyping of T1 lineages across eight independent transgenic events for resistance revealed that i) two of the transgenic events provided resistance to WSMV and TriMV, ii) four events provided resistance to either WSMV or TriMV, and iii) no resistance was found in two other events. T2 populations derived from the two events classified as dual-resistant were subsequently monitored for stability of the resistance phenotype through the T4 generation. The resistance phenotype in these events was temperature-dependent, with a complete dual resistance at temperatures ≥25°C and an increasingly susceptible response at temperatures below 25°C. Northern blot hybridization of total RNA from transgenic wheat revealed that virus-specific small RNAs (vsRNAs) accumulated progressively with an increase in temperature, with no detectable levels of vsRNA accumulation at 20°C. Thus, the resistance phenotype of wheat harboring an RNAi element was correlated with accumulation of vsRNAs, and the generation of vsRNAs can be used as a molecular marker for the prediction of resistant phenotypes of transgenic plants at a specific temperature.

Cloning and Characterization of Partial Chlorophyll a Oxygenase (CAO) Gene Involved in Soybean Shade Tolerance Mechanism

Plant tolerance mechanism under shade stress is indicated by high chlorophyll-b content, which is synthesized from chlorophyll a by chlorophyll a-oxygenase (CAO) gene. The study was aimed to clone and characterize the partial of CAO gene involved in shade tolerance mechanism in soybean. Total RNA was isolated from the second trifoliate leaves of soybean plants and the first strand cDNA was prepared using Reverse Transcriptase Moloney Murine Leukemia Virus (RT-M-MLV) (RNase H-). Northern blot hybridization was used to analyze expression of partial CAO gene. The result showed that one partial gene, CAO 3-4 (1,052 bp), comprised of 292 adenine (a), 241 cytosine (c), 276 guanine (g) and 242 thymine (t), therefore the number of amino acid deduction was 338. The expression of CAO 3-4 partial gene was higher in shade tolerant genotypes than in shade sensitive genotypes, both under 50% shade and dark. These results demonstrated that the CAO gene is involved in shade tolerance mechanism of soybean.

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

First Report of Chrysanthemum chlorotic mottle viroid in Chrysanthemum in China

During the spring of 2008, a chrysanthemum plant showing mild mottle on young leaves was observed in a garden in Beijing, China. After the plant was moved into a greenhouse, symptoms became severe with obvious yellowing and complete chlorosis on new leaves. In addition, when a survey was conducted for chrysanthemum diseases in 2010, plants with mild chlorotic spots on leaves were also found occasionally in a commercial field in Hainan, China. These symptoms resembled symptoms induced by Chrysanthemum chlorotic mottle viroid (CChMVd). Therefore, total RNA of 13 samples collected from Beijing (cultivar unknown) and Hainan (cv. Golden) was extracted according to Li et al. (2) and tested for CChMVd by northern blot hybridization using DIG-labeled CChMVd cRNA probe (1). All samples were CChMVd positive, and the healthy control was negative. The viroid was further confirmed by reverse transcription (RT)-PCR using CChMVd specific primers (forward: 5′-AGGTCGTA(T)AAACTTCCCCTCTAAA(G)CG-3′, homologous to nucleotides 134 to 159; and reverse: 5′-TCCAGTCGAGACCTGAAGTGGGTTTC-3′, complementary to nucleotides 133 to 108) (1). Two amplified products of approximately 400 bp were cloned into the pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells. Two positive clones were obtained from each isolate and sequenced. Four sequences obtained have been submitted to GenBank (Accession Nos. HQ891014 to HQ891017). Sequence analysis revealed that the obtained sequences shared 96.49 to 96.99% similarity with the reference sequence CChMVd (GenBank Accession No. NC003540). All the clones are 399 nucleotides long and are thought to be the symptomatic type based on their UUUC sequence at positions 82 to 85 in the CChMVd tetraloop (1). In addition, both isolates were mechanically inoculated to three healthy chrysanthemum plants of the unknown cultivar from Beijing. All inoculated plants developed chlorosis after 5 weeks and CChMVd infections were confirmed by northern blot hybridization and RT-PCR. CChMVd is an important pathogen that may potentially cause losses to the chrysanthemum industry. It is necessary to survey for CChMVd infection in various chrysanthemums cultivated in China. To our knowledge, this is the first report of CChMVd in chrysanthemum in China. References: (1) P. M. De la Pena et al. Proc. Natl. Acad. Sci. USA. 96:9960, 1999. (2) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.