scholarly journals First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Alejandro Olmedo Velarde ◽  
Avijit Roy ◽  
Chellappan Padmanabhan ◽  
Schyler Nunziata ◽  
Mark K Nakhla ◽  
...  
Keyword(s):  
South Africa ◽  
Average Depth ◽  
Gene Sequences ◽  
Rt Pcr ◽  
Citrus Jambhiri ◽  
Total Rna ◽  
Orchid Fleck Virus ◽  
Rough Lemon ◽  
Symptomatic Tissue ◽  
Citrus Leprosis

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

scholarly journals First report of Coguvirus eburi infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Rt Pcr ◽  
Disease Symptoms ◽  
Total Rna ◽  
First Report ◽  
Pcr Assays

Coguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Khun et al., 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al., 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al., 2019). More recently CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data was trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (Default parameters) using high quality reads yielded 75250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9400 nts and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5’ and 3’ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al., 2018). After splitting and curation, the RNA1 contig was 6664 nts and the RNA2 contig 2686 nts. A total of 51397 and 34820 reads were used to construct these contigs resulting in an average depth of coverage of 761 and 1281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1 % of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2 respectively (Bester et al. (2021)) were used to generate amplicons. Amplicon sequences were confirmed with bi-directional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples) and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and wide-spread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.

Orchid fleck virus associated with the first case of citrus leprosis-N in South Africa

2019 ◽  
Vol 155 (4) ◽  
pp. 1373-1379 ◽  
Author(s):  
Glynnis Cook ◽  
Wayne Kirkman ◽  
Rochelle Clase ◽  
Chanel Steyn ◽  
Elaine Basson ◽  
...  
Keyword(s):  
South Africa ◽  
Orchid Fleck Virus ◽  
First Case ◽  
Citrus Leprosis

scholarly journals First Report of Citrus leprosis virus Nuclear Type in Sweet Orange in Colombia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1162-1162 ◽  
Author(s):  
Avijit Roy ◽  
M. G. León ◽  
A. L. Stone ◽  
J. S. Hartung ◽  
R. H. Brlansky
Keyword(s):  
Mixed Infection ◽  
Protein Gene ◽  
Sweet Orange ◽  
N Gene ◽  
Rt Pcr ◽  
M Gene ◽  
Total Rna ◽  
First Report ◽  
Citrus Leprosis ◽  
Cytoplasmic Type

Colombia is ranked 18th in the world in citrus production and contributed 0.9% of the total world share. Among four important citrus-producing regions of Colombia, the Orinoco region (3 to 6°N, 68 to 74°W) consists of two citrus-producing states, Meta and Casanare. Citrus leprosis is the most important viral disease of citrus in Colombia (1,3). Three types of Citrus leprosis virus (CiLV) infect citrus, producing leprosis-like lesion symptoms. Two of the three CiLV species, Citrus leprosis virus cytoplasmic type (CiLV-C) and cytoplasmic type 2 (CiLV-C2), produce particles only in the cytoplasm (3). The other species, Citrus leprosis virus nuclear type (CiLV-N), produces particles in both the cytoplasm and nucleus (4). CiLV-C is more prevalent and destructive while CiLV-N has been reported only in Brazil, Panama, and Mexico (4). Interestingly, both CiLV-C and -C2 were reported from the same regions of Meta and Casanare States in Colombia in 2004 and 2012 (1,3). CiLV-C lesions are usually rounded (initially 2 to 3 mm in diameter and extending up to 30 mm), have dark-brown or greenish central chlorotic spots, and are surrounded by yellow halos. CiLV-N lesions have been described as smaller in size and form three well-defined regions including a necrotic center with an intermediate orange color halo and an outer chlorotic halo (2). In 2013, ‘Valencia’ sweet orange (Citrus sinensis L.) leaves with suspected CiLV-N symptoms were collected from 8 plants in Casanare State and shipped under permit to the USDA-APHIS-PPQ-CPHST, Beltsville, MD. Total RNA from symptomatic and healthy sweet orange leaves were extracted using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR primers specific to CiLV-C, CiLV-C2 (3), and CiLV-N nucleocapsid (N) (CiLV-N-NPF: 5′-ATGGCTAACCCAAGTGAGATCGATTA-3′; CiLV-N-NPR: 5′-AGTTGCCTTGAGATCATCACATTGGT-3′) and putative matrix protein (M) genes (CiLV-N-MF: 5′-ATGTCTAAACAGATTAATATGTGCACTGTG-3′; CiLV-N-MR: 5′-CTAACCACTGGGTCCCGC-3′) were utilized to identify the CiLV associated with the leprosis-affected leaf samples from Casanare. RT-PCR with CiLV-C primers failed to produce any amplicon, but CiLV-N primers successfully amplified the partial N gene (681 bp) and entire M gene (552 nt) amplicons from multiple leaves of all leprosis samples. In addition, a 795-bp amplicon specific to CiLV-C2 also was amplified from the CiLV-N suspected samples. Similar results were obtained when the vector, flat spider mite (Brevipalpus spp.) total RNA was used as template for RT-PCR. For further confirmation, each amplicon was cloned and sequenced. Sequencing of the N and M gene amplicons of CiLV-N (accession nos. KJ195893 and KJ195894) and coat protein gene of CiLV-C2 showed 97 to 99% nucleotide sequence identity with the CiLV-N M2345 isolate sequence (KF209275) from Mexico (4) and CiLV-C2 L147V1 isolate sequence (JX000024) from Colombia (3), respectively. Phylogenetic analyses of these N and M protein gene sequences confirmed a mixed infection of the same plant with two viruses, one from an unassigned new genus Dichorhavirus (CiLV-N) and another from genus Cilevirus (CiLV-C2). This is the first report of CiLV-N in Colombia, and also the first report of an occurrence of CiLV-N in mixed infection with CiLV-C2. All three known species of CiLV occur in the Orinoco region of Colombia. References: (1) M. G. León et al. Plant Dis. 90: 682, 2006. (2) J. P. R. Marques et al. Anais da Academia Brasileira de Ciências 82:501, 2010. (3) A. Roy et al. Phytopathology 103:488, 2013. (4) A. Roy et al. Genome Announc. 1(4): e00519-13, 2013.

scholarly journals Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico

2020 ◽  
Vol 110 (1) ◽  
pp. 106-120 ◽  
Author(s):  
Avijit Roy ◽  
Andrew L. Stone ◽  
Gabriel Otero-Colina ◽  
Gang Wei ◽  
Ronald H. Brlansky ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Sensu Stricto ◽  
Genome Segment ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
Orchid Fleck Virus ◽  
Reverse Transcription Pcr ◽  
Sequencing Technologies ◽  
Negative Sense

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit–specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit–specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

Geraniol synthase whose mRNA is induced by host-selective ACT-toxin in the ACT-toxin-insensitive rough lemon (Citrus jambhiri)

2012 ◽  
Vol 169 (14) ◽  
pp. 1401-1407 ◽  
Author(s):  
Hodaka Shishido ◽  
Yoko Miyamoto ◽  
Rika Ozawa ◽  
Shiduku Taniguchi ◽  
Junji Takabayashi ◽  
...  
Keyword(s):  
Citrus Jambhiri ◽  
Geraniol Synthase ◽  
Rough Lemon

Water relations of rough lemon (Citrus jambhiri Lush.) citrus seedlings infected withFusarium solani

1986 ◽  
Vol 93 (2) ◽  
pp. 231-239 ◽  
Author(s):  
S. Nemec ◽  
J. Syversten ◽  
Y. Levy
Keyword(s):  
Water Relations ◽  
Citrus Jambhiri ◽  
Rough Lemon

Per-unit-living tissue normalization of real-time RT-PCR data in ischemic rat hearts

2012 ◽  
Vol 44 (12) ◽  
pp. 651-656 ◽  
Author(s):  
S. Ellefsen ◽  
M. Bliksøen ◽  
A. Rutkovskiy ◽  
I. B. Johansen ◽  
M.-L. Kaljusto ◽  
...  
Keyword(s):  
Infarct Size ◽  
Real Time ◽  
Reference Genes ◽  
Stable Expression ◽  
Unit Weight ◽  
Living Tissue ◽  
Rt Pcr ◽  
Internal Reference ◽  
Total Rna ◽  
Rat Hearts

In studies of gene expression in acute ischemic heart tissue, internal reference genes need to show stable expression per-unit-living tissue to hinder dead cells from biasing real-time RT-PCR data. Until now, this important issue has not been appropriately investigated. We hypothesized that the expression of seven internal reference genes would show stable per-unit-living tissue expression in Langendorff-perfused rat hearts subjected to ischemia-reperfusion. This was found for cyclophilin A, GAPDH, RPL-32, and PolR2A mRNA, with GAPDH showing the highest degree of stability ( R = 0.11), suggesting unchanged rates of mRNA transcription in live cells and complete degradation of mRNA from dead cells. The infarct size-dependent degradation of GAPDH was further supported by a close correlation between changes in GAPDH mRNA and changes in RNA quality measured as RNA integrity number (R = 0.90, P < 0.05). In contrast, β-actin and 18S rRNA showed stable expression per-unit-weight tissue and a positive correlation with infarct size (R = 0.61 and R = 0.77, P < 0.05 for both analyses). The amount of total RNA extracted per-unit-weight tissue did not differ between groups despite wide variation in infarct size (7.1–50.1%). When β-actin expression was assessed using four different normalization strategies, GAPDH and geNorm provided appropriate per-unit-living expression, while 18S and total RNA resulted in marked underestimations. In studies of ischemic tissues, we recommend using geometric averaging of carefully selected reference genes for normalization of real-time RT-PCR data. A marked shift in the mRNA/rRNA ratio renders rRNA as useless for normalization purposes.

scholarly journals Iris yellow spot virus in Onion Seed Crops in South Africa

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1203-1203 ◽  
Author(s):  
L. J. du Toit ◽  
J. T. Burger ◽  
A. McLeod ◽  
M. Engelbrecht ◽  
A. Viljoen
Keyword(s):  
South Africa ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Western Cape ◽  
Spot Virus ◽  
Total Rna ◽  
Onion Seed ◽  
Seed Crops ◽  
Np Gene

In December 2006, symptoms typical of iris yellow spot caused by Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) were observed on scapes (seed stalks) in an onion (Allium cepa L.) seed crop in the Klein Karoo of the Western Cape Province, South Africa. Symptoms included diamond-shaped chlorotic or necrotic lesions on the scapes, some of which had ‘green-islands’ with nested diamond-shaped lesions, as well as indistinct, circular to irregular, chlorotic or necrotic lesions of various sizes. At the time symptoms were observed, approximately 5% of the scapes had lodged as a result of extensive lesions resembling those caused by IYSV. The crop was 2 to 3 weeks from harvest. Symptomatic tissue from two plants (two samples from one plant and four samples from the other plant) was tested for IYSV by reverse-transcriptase (RT)-PCR. Total RNA was extracted from symptomatic scape tissue with the SV Total RNA Isolation System (Promega, Madison, WI) according to the manufacturer's instructions. First strand cDNA was synthesized with the RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas Inc., Hanover, MD), followed by PCR amplification with primers IYSV-For (TGG YGG AGA TGY RGA TGT GGT) and IYSV-Rev (ATT YTT GGG TTT AGA AGA CTC ACC), which amplify the nucleocapsid (NP) gene of IYSV. An amplicon of expected size (approximately 750 bp) was observed for each of the symptomatic plants assayed and was sequenced. Comparison of the sequence (GenBank Accession No. EF579801) with GenBank sequences revealed 95% sequence identity with the NP gene of IYSV GenBank Accession No. EF419888, with eight amino acid differences. The known geographic distribution of IYSV in onion bulb or seed crops has increased rapidly in recent years in many areas of the world (1). To our knowledge, this is the first confirmation of IYSV in South Africa. Approximately 6,100 ha of onion bulb crops are grown annually in South Africa in the Western Cape, Kwazulu Natal, Limpopo, and Northern Cape provinces, and 600 ha of onion seed crops are grown primarily in the semi-arid regions of the Western Cape. Examination of an additional 10 onion seed crops in the Klein Karoo during January 2007 revealed the presence of iris yellow spot in three more crops at approximately 5% incidence in each crop. The four symptomatic crops had all been planted as bulb-to-seed crops, using vernalized bulbs produced on the same farm. This suggests that IYSV may have been disseminated into the seed crops on the vernalized bulbs, either as infected bulb tissue or in viruliferous thrips on the bulbs. Reference: (1) D. H. Gent et al. Plant Dis. 90:1468, 2006.

Sign in / Sign up

Export Citation Format

Share Document