Heterologous expression of a polyketide synthase ACRTS2 in Aspregillus oryzae produces host selective ACR-toxins: Co-production of minor metabolites

Previously, we succeeded to produce the core structure of the host-selective ACR-toxin (1) on brown leaf spot on rough lemon when the polyketide synthase ACRTS2 gene was heterologously expressed in Aspergillus oryzae (AO). To confirm the production of 1 in AO, the detection limit and suppressing decarboxylation were improved, and these efforts led us to conclude the direct production of 1 instead of its decarboxylation product. During this examination, minor ACR-toxin-related metabolites were found. Their structure determination enabled us to propose a decarboxylation mechanism and novel branching route forming byproducts from the coupling of the dihydropyrone moiety of 1 with the acetaldehyde and kojic acid abundant in AO. The involvement of putative cyclase ACRTS3 in the chain release of linear polyketide was excluded by the co-expression analysis of ACRTS2 and ACRTS3. Taken together, we concluded the production of 1 in AO is solely responsible for ACRTS2.

Different Host Plants Distinctly Influence the Feeding Ability of the Brown Citrus Aphid Toxoptera citricida

Piercing–sucking insects are important crop pests, and an understanding of their feeding behavior and population development plays a crucial role in studying insect population dynamics and crop resistance. In our study, we examined the probing behavior of the brown citrus aphid, Toxoptera citricida, using electropenetrography and assessed its population development after 8 days on seven host plants: Yuzu, Citrus junos Sieb. ex Tanaka; Rough Lemon, C. jambhiri Lush.; ‘Luofu’ kumquat, Fortunella margarita Swingle; ‘Olinda’ valencia orange, C. sinensis (L.) Osbeck; ‘Yanxiwanlu’ Ponkan, C. reticulata Blanco; ‘Rohde Red’ valencia orange, C. sinensis; and ‘Eureka’ lemon, C. limon (L.) Osbeck. The results demonstrated that probing by the brown citrus aphid differed significantly according to the target hosts. Toxoptera citricida produced significantly more pathway activities on Eureka than on Rough Lemon and Yuzu. Toxoptera citricida spent more time from the first probe to first salivation into phloem sieve elements on Eureka compared to Yuzu. In addition, the total duration of ingestion from sieve cells of each aphid in the phloem-feeding phase was shortest on Eureka, and this was significantly shorter than that on Yuzu, Rough Lemon, Luofu, and Olinda. The population number of T. citricida on Eureka after 8 days was significantly lower than that on the other hosts. Overall, Eureka was found to have obvious resistance to T. citricida, whereas Yuzu and Rough Lemon were susceptible host plants. These results provide a theoretical basis for exploring aphid-resistant fruit tree resources using resistant varieties.

Synergism of citrus nematode (Tylenchulus semipenetrans Cobb.) and Colletotrichum gloeosporioides plays a major role in citrus dieback

Citrus is known as a major fruit due to its high nutritional value and adaptability in tropical and sub-tropical regions. Among diseases, citrus dieback is one of the most threatening diseases in which overall plant growth is reduced. Major causes are Colletotrichum gloeosporioides and citrus nematode (Tylenchulus semipenetrans) with 15-35% losses all over the world. Plant material was established adopting sanitary measures in earthen pots (12-inch diameter). Fresh culture of C. gloeosporioides and T. semipenetrans was prepared for the inoculation by following the standard procedures. In the first set, rootstocks were inoculated with 200mL of water having spore suspension of C. gloeosporioides while in in the second set, inoculation of T. semipenetrans was done by using 45 mL of water suspension having 2000 freshly hatched juveniles per pot, while at the rate of 1 × 107 spores/mL per plant. In the third set, the interaction of C. gloeosporioides and T. semipenetrans was studied by inoculating selected citrus rootstocks by both pathogens. After four months of inoculation, data were recorded on plant disease index (PDI) along with plant growth parameters (root weight, shoot weight, shoot weight, shoot length and number of leaves). Trifoliate orange and cox mandarin hybrid showed resistance against the development of T. semipenetrans while rough lemon, C-35 Citrange and sour orange were found susceptible. There was a significant difference in plant growth parameters between inoculated and healthy plants. Root weight and shoot weight decreased by 8.98g and 11.53g, while root length and shoot length decreased by 7.29cm and 13.5cm respectively as compared to control treatments in most susceptible rootstocks. Per cent Branch Infection (PBI) and per cent Disease Index (PDI) were maximum (71.52, 37) per cent on rough lemon respectively. Results regarding combined inoculation of C. gloeosporioides and T. semipenetrans showed that there was a significant difference in plant growth parameters between inoculated and healthy plants. In rough lemon, Root weight and shoot weight decreased by 13.86 and 20.57g respectively in diseased and healthy plants. Root length and shoot length decreased by 8.37 and 20.04cm respectively as compared to control treatments in most susceptible rootstocks. Overall results depicted that inoculation of both pathogens reduced plant growth more severely as compared to their individual application.

Rootstocks Genotypes Impact on Tree Development and Industrial Properties of ‘Valencia’ Sweet Orange Juice

The low diversification of rootstock genotypes in orchards limits the expansion of the citrus industry, restricting increases in productivity and cost-saving via phytosanitary treatments and other horticultural practices. Therefore, the aim of this study was to assess the impact of rootstock genotypes on tree development and industrial properties of ‘Valencia’ sweet orange juice (Citrus sinensis). Twenty rootstock genotypes were evaluated by measuring tree growth and industrial properties of orange juices, including ‘Trifoliata’ hybrids with tangerine (citrandarins) and grapefruit (citrumelos), as well ‘Rangpur’ lime and other potential rootstocks. The experimental orchard was planted in Rancho Alegre, PR, Brazil, under clay soil and subtropical rainfed conditions. A randomized block design with four replicates was used. Trees grown on IPEACS–239 and IPEACS–256 citrandarins, and on ‘US–802’ pummelo hybrid had low vigor, high production efficiency and high industrial properties of orange juice, and are therefore potential alternatives for high-density plantings. The F.80–3 and F.80–5 citrumelos also had good dwarfing potential and high production efficiency, but lower industrial properties of juice compared to the other ‘Trifoliata’ hybrid rootstocks. Trees grown on ‘US–812’ citrandarin rootstock had low vigor, good productive performance, accumulated production and production efficiency similar to ‘Rangpur’ lime, and high industrial properties of juices. Although the ‘Rangpur’ lime and the ‘Florida’ rough lemon allowed high yields, the trees are very vigorous, with low-quality fruits. A Quick Reference Chart was created to provide practical and objective identification of the best rootstock alternatives for ‘Valencia’ orange trees in terms of tree development and industrial properties of juices.

Soil application of fungicides affects nutrient dynamics in ‘Blood Red’ sweet orange

Infected and damaged root system of sweet oranges (Citrus sinensis Osbeck L.) budded on rough lemon (Citrus jambheri Lush.) in Punjab-Pakistan has been suspected to affect nutrient uptake due to rootstock susceptibility to soil born fungal diseases. The experiment was performed on 12-15 years old ‘Blood Red’ sweet orange ‘Blood Red’) trees of uniform size and vigour at the Fruit Garden Sq. 9, Institute of Horticultural Sciences, University of Agriculture, Faisalabad, Punjab, Pakistan. This study was conducted for consecutive two years. The objective of the research was to introduce sweet oranges in the main streamline of the citrus industry by improving their root health through fungicides treatments ultimately enhancing mineral nutrient uptake from the soil. The experiment was laid out according to Randomized Complete Block Design (RCBD) replicated thrice, taking a single tree as a treatment unit. The fungicides used in the experiment were Metalaxyl Mencozeb (Ridomil Gold), Fosetyl-Al (Alliette) and copper sulphate (CuSO4), in different combinations. Nutritional status of tree leaf macronutrients (N, P and K) and micronutrients (Mg, Fe, Mn, Cu and Zn) during flowering and final fruit set was evaluated at fortnight intervals with respect to different treatments. The different treatments enhanced nutrient uptake through roots and improved health and vigour of trees. It was more evident from the improvement of fruit quality and yield of treated trees compared with control. Although fungal analysis could not be performed, the improvement in general health and vigour of trees lead to the conclusion that root health was improved substantially. It might be concluded from this study that best orchard management emphasizing improvement in the root health could enhance the yield and quality of sweet oranges.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

De Novo Transcriptome Sequencing of Rough Lemon Leaves (Citrus jambhiri Lush.) in Response to Plenodomus tracheiphilus Infection

Mal secco is one of the most severe diseases of citrus, caused by the necrotrophic fungus Plenodomus tracheiphilus. With the main aim of identifying candidate genes involved in the response of citrus plants to “Mal secco”, we performed a de novo transcriptome analysis of rough lemon seedlings subjected to inoculation of P. tracheiphilus. The analysis of differential expressed genes (DEGs) highlighted a sharp response triggered by the pathogen as a total of 4986 significant DEGs (2865 genes up-regulated and 2121 down-regulated) have been revealed. The analysis of the most significantly enriched KEGG pathways indicated that a crucial role is played by genes involved in “Plant hormone signal transduction”, “Phenylpropanoid biosynthesis”, and “Carbon metabolism”. The main findings of this work are that under fungus challenge, the rough lemon genes involved both in the light harvesting and the photosynthetic electron flow were significantly down-regulated, thus probably inducing a shortage of energy for cellular functions. Moreover, the systemic acquired resistance (SAR) was activated through the induced salicylic acid cascade. Interestingly, RPM1 interacting protein 4, an essential positive regulator of plant defense, and BIR2, which is a negative regulator of basal level of immunity, have been identified thus representing useful targets for molecular breeding.