Spontaneous Mutation in the Movement Protein of Citrus Leprosis Virus C2, in a Heterologous Virus Infection Context, Increases Cell-to-Cell Transport and Generates Fitness Advantage

Previous results using a movement defective alfalfa mosaic virus (AMV) vector revealed that citrus leprosis virus C (CiLV-C) movement protein (MP) generates a more efficient local movement, but not more systemic transport, than citrus leprosis virus C2 (CiLV-C2) MP, MPs belonging to two important viruses for the citrus industry. Here, competition experiment assays in transgenic tobacco plants (P12) between transcripts of AMV constructs expressing the cilevirus MPs, followed by several biological passages, showed the prevalence of the AMV construct carrying the CiLV-C2 MP. The analysis of AMV RNA 3 progeny recovered from P12 plant at the second viral passage revealed the presence of a mix of progeny encompassing the CiLV-C2 MP wild type (MPWT) and two variants carrying serines instead phenylalanines at positions 72 (MPS72F) or 259 (MPS259F), respectively. We evaluated the effects of each modified residue in virus replication, and cell-to-cell and long-distance movements. Results indicated that phenylalanine at position 259 favors viral cell-to-cell transport with an improvement in viral fitness, but has no effect on viral replication, whereas mutation at position 72 (MPS72F) has a penalty in the viral fitness. Our findings indicate that the prevalence of a viral population may be correlated with its greater efficiency in cell-to-cell and systemic movements.

Citrus leprosis virus C (leprosis of citrus).

CiLV-C is a quarantine pest which causes an economically important disease, reported only on the American continent. During the past 15 years, it has caused economic losses in Brazil, Argentina, Paraguay, Uruguay, Venezuela, Costa Rica, Panamá and Honduras. The disease was recently reported in Guatemala, Bolivia, México, Colombia and Belize. It is a threat to citrus-producing countries where the disease has not been reported. The disease can cause 100% yield loss (Rodrigues et al., 2000).

Molecular Epidemiology of Citrus Leprosis Virus C: A New Viral Lineage and Phylodynamic of the Main Viral Subpopulations in the Americas

Despite the importance of viral strains/variants as agents of emerging diseases, genetic and evolutionary processes affecting their ecology are not fully understood. To get insight into this topic, we assessed the population and spatial dynamic parameters of citrus leprosis virus C (CiLV-C, genus Cilevirus, family Kitaviridae). CiLV-C is the etiological agent of citrus leprosis disease, a non-systemic infection considered the main viral disorder affecting citrus orchards in Brazil. Overall, we obtained 18 complete or near-complete viral genomes, 123 complete nucleotide sequences of the open reading frame (ORF) encoding the putative coat protein, and 204 partial nucleotide sequences of the ORF encoding the movement protein, from 430 infected Citrus spp. samples collected between 1932 and 2020. A thorough examination of the collected dataset suggested that the CiLV-C population consists of the major lineages CRD and SJP, unevenly distributed, plus a third one called ASU identified in this work, which is represented by a single isolate found in an herbarium sample collected in Asuncion, Paraguay, in 1937. Viruses from the three lineages share about 85% nucleotide sequence identity and show signs of inter-clade recombination events. Members of the lineage CRD were identified both in commercial and non-commercial citrus orchards. However, those of the lineages SJP were exclusively detected in samples collected in the citrus belt of São Paulo and Minas Gerais, the leading Brazilian citrus production region, after 2015. The most recent common ancestor of viruses of the three lineages dates back to, at least, ∼1500 years ago. Since citrus plants were introduced in the Americas by the Portuguese around the 1520s, the Bayesian phylodynamic analysis suggested that the ancestors of the main CiLV-C lineages likely originated in contact with native vegetation of South America. The intensive expansion of CRD and SJP lineages in Brazil started probably linked to the beginning of the local citrus industry. The high prevalence of CiLV-C in the citrus belt of Brazil likely ensues from the intensive connectivity between orchards, which represents a potential risk toward pathogen saturation across the region.

Citrus leprosis virus C (leprosis of citrus).

CiLV-C is a quarantine pest which causes an economically important disease, reported only on the American continent. During the past 15 years, it has caused economic losses in Brazil, Argentina, Paraguay, Uruguay, Venezuela, Costa Rica, Panamá and Honduras. The disease was recently reported in Guatemala, Bolivia, México, Colombia and Belize. It is a threat to citrus-producing countries where the disease has not been reported. The disease can cause 100% yield loss (Rodrigues et al., 2000). CiLV does not appear to move systemically in the host plant but can move short distances from a grafted shoot tip to the adjacent scion tissue. Accordingly, movement in latently infected planting material is not likely to be a major pathway for CiLV-C because of its non-systemic infection, CiLV-C can only be important where attacks by its vector mites are significant. The main means of movement and dispersal of the virus is via the vector mites of the genus Brevipalpus, which colonize most species of Citrus and many other plant species.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Membrane Association and Topology of Citrus Leprosis Virus C2 Movement and Capsid Proteins

Although citrus leprosis disease has been known for more than a hundred years, one of its causal agents, citrus leprosis virus C2 (CiLV-C2), is poorly characterized. This study described the association of CiLV-C2 movement protein (MP) and capsid protein (p29) with biological membranes. Our findings obtained by computer predictions, chemical treatments after membrane fractionation, and biomolecular fluorescence complementation assays revealed that p29 is peripherally associated, while the MP is integrally bound to the cell membranes. Topological analyses revealed that both the p29 and MP expose their N- and C-termini to the cell cytoplasmic compartment. The implications of these results in the intracellular movement of the virus were discussed.

Unravelling the involvement of cilevirus p32 protein in the viral transport

Citrus leprosis (CL) is a severe disease that affects citrus orchards mainly in Latin America. It is caused by Brevipalpus-transmitted viruses from genera Cilevirus and Dichorhavirus. Currently, no reports have explored the movement machinery for the cilevirus. Here, we have performed a detailed functional study of the p32 movement protein (MP) of two cileviruses. Citrus leprosis-associated viruses are not able to move systemically in neither their natural nor experimental host plants. However, here we show that cilevirus MPs are able to allow the cell-to-cell and long-distance transport of movement-defective alfalfa mosaic virus (AMV). Several features related with the viral transport were explored, including: (i) the ability of cilevirus MPs to facilitate virus movement on a nucleocapsid assembly independent-manner; (ii) the generation of tubular structures from transient expression in protoplast; (iii) the capability of the N- and C- terminus of MP to interact with the cognate capsid protein (p29) and; (iv) the role of the C-terminus of p32 in the cell-to-cell and long-distance transport, tubule formation and the MP-plasmodesmata co-localization. The MP was able to direct the p29 to the plasmodesmata, whereby the C-terminus of MP is independently responsible to recruit the p29 to the cell periphery. Furthermore, we report that MP possess the capacity to enter the nucleolus and to bind to a major nucleolar protein, the fibrillarin. Based on our findings, we provide a model for the role of the p32 in the intra- and intercellular viral spread.