citrus jambhiri
Recently Published Documents


TOTAL DOCUMENTS

89
(FIVE YEARS 6)

H-INDEX

15
(FIVE YEARS 0)

Agrotecnia ◽  
2021 ◽  
pp. 23
Author(s):  
Melisa J. Hidalgo ◽  
Griselda R. R. Bóbeda ◽  
Marco D. Chabbal ◽  
Lucía M. Ponce de León ◽  
Laura I. Giménez
Keyword(s):  

El objetivo de este trabajo fue modelar el crecimiento de limonero ‘Eureka’ (Citrus limón (L.) Burn f) injertado sobre Limón Rugoso (Citrus jambhiri Lush), desde los 60 días después de plena floración hasta la cosecha, en plantaciones comerciales, de la provincia de Corrientes, Argentina. Para ello se registró el diámetro ecuatorial de frutos desde los 60 días después de plena floración hasta el momento de cosecha en cuatro ambientes de la provincia de Corrientes, Argentina. Para describir el crecimiento se compararon los modelos no lineales de tipo sigmoideo: logístico, Gompertz y monomolecular. Se utilizaron como criterios de selección de los modelos: AIC, BIC y el CME (cuadrado medio del error). La precisión del modelo seleccionado se obtuvo mediante validación cruzada. Los modelos seleccionados para describir el crecimiento de frutos de limonero ‘Eureka’ fueron los modelos monomolecular y logístico, los cuales tuvieron un error de estimación que fue medido en términos del CME con valores menores a 20,03. Los parámetros estimados para los modelos seleccionados resultaron significativos (p < 0,01). De esta manera, productores, y empresas exportadoras citrícolas de la región podrán contar con una herramienta con la que puedan predecir la producción al momento de cosecha y así para prever estrategias de comercialización.



Fruits ◽  
2021 ◽  
Vol 76 (5) ◽  
pp. 236-247
Author(s):  
J. Singh ◽  
◽  
R. Singh ◽  
H.S. Dhaliwal ◽  
G.S. Sidhu ◽  
...  


Plant Disease ◽  
2021 ◽  
Author(s):  
Alejandro Olmedo Velarde ◽  
Avijit Roy ◽  
Chellappan Padmanabhan ◽  
Schyler Nunziata ◽  
Mark K Nakhla ◽  
...  

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.



PLoS ONE ◽  
2021 ◽  
Vol 16 (2) ◽  
pp. e0246971
Author(s):  
Tongbram Roshni Devi ◽  
Madhumita Dasgupta ◽  
Manas Ranjan Sahoo ◽  
Paresh Chandra Kole ◽  
Narendra Prakash

A protocol for high-frequency direct organogenesis from root explants of Kachai lemon (Citrus jambhiri Lush.) was developed. Full-length roots (~3 cm) were isolated from the in vitro grown seedlings and cultured on Murashige and Skoog basal medium supplemented with Nitsch vitamin (MSN) with different concentrations of cytokinin [6-benzylaminopurine, (BAP)] and gibberellic acid (GA3). The frequency of multiple shoot proliferation was very high, with an average of 34.3 shoots per root explant when inoculated on the MSN medium supplemented with BAP (1.0 mg L–1) and GA3 (1.0 mg L–1). Optimal rooting was induced in the plantlets under half strength MSN medium supplemented with indole-3-acetic acid (IAA, 0.5–1.0 mg L–1). IAA induced better root structure than 1-naphthaleneacetic acid (NAA), which was evident from the scanning electron microscopy (SEM). The expressions of growth regulating factor genes (GRF1 and GRF5) and GA3 signaling genes (GA2OX1 and KO1) were elevated in the regenerants obtained from MSN+BAP (1.0 mg L-1)+GA3 (1.0 mg L-1). The expressions of auxin regulating genes were high in roots obtained in ½ MSN+IAA 1.0 mg L-1. Furthermore, indexing of the regenerants confirmed that there was no amplicons detected for Huanglongbing bacterium and Citrus tristeza virus. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeat (ISSR) markers detected no polymorphic bands amongst the regenerated plants. This is the first report that describes direct organogenesis from the root explant of Citrus jambhiri Lush. The high-frequency direct regeneration protocol in the present study provides an enormous significance in Citrus organogenesis, its commercial cultivation and genetic conservation.



Author(s):  
Ashrafi Papry ◽  
Sayeda Sultana ◽  
Goutam Deb ◽  
Mohammed Bhuiyan


protocols.io ◽  
2020 ◽  
Author(s):  
Tongbram Roshni ◽  
Madhumita Dasgupta ◽  
MANAS RANJAN ◽  
Paresh Chandra ◽  
Narendra Prakash


Author(s):  
Mudasir Iqbal ◽  
Parshant Bakshi ◽  
B. K. Sinha ◽  
Mohsin Iqbal ◽  
Arti Devi

Many species of Citrus and compatible sexual relatives are being used to develop biotic and abiotic tolerant rootstocks and their ability to confer positive stionic effects. Citrus jambhiri is the commercial citrus rootstock in India, deep-rooted well adapted to the diverse agro-climatic conditions. It ensures high yield with large size fruits in most of the scion cultivars and at the same time is resistant to most of the viruses. For in vitro mutagenesis, leaf and epicotyl calli derived shoots were used as explant material. In-vitro mutagenesis is a valuable tool for improvement of a crop, especially when there is a need to add one or two easily identifiable characters in an otherwise well adapted variety, without disturbing its basic genotype. The alkylating agent methyl methane sulphonate (MMS) and ethyl methane sulphonate (EMS) at 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6%, were used for mutagenesis. The mutagenic calli derived shoots were regenerated on MS medium augmented with BAP (3.0 mg/l), followed by rooting in MS medium containing NAA (2.0 mg/l). Percent rooting (29.50-8.33%), (27.11-07.72%), number of roots per shoot (3.11-1.18), (3.12-1.04) and root length (4.13-2.22), (4.15-2.17) decreased with increasing doses of MMS and EMS treatments, respectively. Effect of increasing age of callus showed that callus retained regeneration capacity (3.55%) even after 210 days of culture by repeated sub-culturing. The plantlets were successfully acclimatized in different potting mixtures and highest survival rate (90.35%) was achieved in potting mixture containing garden soil with sand and farmyard manure (1:1:1).



2020 ◽  
Author(s):  
Priyanka Sharma ◽  
Bidhan Roy

ABSTRACTCitrus jambhiri (Rough lemon) is popularly preferred for rootstock for cultivated species of Citrus. Tissue culture is an appreciable technique for mass-multiplication of plant propagules. In this communication direct regeneration of plantlets of Citrus jambhiri Lush. were obtained from cotyledons, roots and leaves. Most of the cotyledon (96%) enlarged on medium supplemented with 50 mg/L of casein hydrolysate. Few of those enlarged cotyledons responded to direct regeneration of shoots. Maximum shoot per responded cotyledon was 32. Conversely, the health of the plantlets were poor with semi-cylindrical leaves. Most of them dried on maintenance medium or on rooting medium ad died. Plantlets regenerated on medium supplemented with IAA in combination with IBA were healthy and they established on maintenance medium and rooted on rooting medium. Direct regeneration was also obtained from leaf on MS medium supplemented with 0.50 mg/L of dicamba. Our finding concluded that tissue culture tools may be used for direct regeneration of plantlets from different explants of C. jambhiri to obtained true-to-type plant propagules.



Sign in / Sign up

Export Citation Format

Share Document