scholarly journals Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 321-321 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
S. K. Green ◽  
L. M. Lee ◽  
G. C. Luther ◽  
...  
Keyword(s):  
Severe Disease ◽  
Positive Sample ◽  
Tomato Leaf ◽  
Yellow Leaf ◽  
Sequence Comparisons ◽  
Sequence Identity ◽  
North Sulawesi ◽  
Species Demarcation Threshold ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5′CCCGGATCCTCTAATTCATCCCT3′; IndC: 5′GACGGATCCCACATGTTTGCCA3′) was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

Tomato yellow leaf curl disease in Guangdong is caused by Tomato leaf curl Taiwan virus

2007 ◽  
Vol 4 (2) ◽  
pp. 127-131 ◽  
Author(s):  
He Zi-Fu ◽  
Yu Hao ◽  
Mao Ming-Jie ◽  
Luo Fang-Fang ◽  
Lin Yi-Han ◽  
...  
Keyword(s):  
Intergenic Region ◽  
Virus Isolate ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Yellow Leaf ◽  
Sequence Identity ◽  
Begomovirus Genome ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

AbstractA yellow leaf curl disease with chlorotic and yellowish leaves, upward leaf curling and stunting symptoms was observed on tomato in Shantou city of Guangdong province. A virus isolate BS was obtained from a diseased tomato plant. The complete DNA-A sequence of the virus isolate BS was determined to be 2740 nucleotides long, with all the characteristic features of begomovirus genome organization. BS DNA-A encoded six potential open reading frames (ORFs), with two (AV1 and AV2) in virus sense and four (AC1, AC2, AC3 and AC4) in complementary sense, and contained an intergenic region of 269 nucleotides. The results of BLAST searches showed that BS DNA-A had higher sequence identity with reported begomoviruses in Asia than with those in America and Africa. Further sequence comparisons indicated that BS was most closely related to the isolate of Tomato leaf curl Taiwan virus (ToLCTWV-[Taiwan]) with a sequence identity of 97.7%. Nucleotide sequence identities of AV1, AV2, AC1, AC2, AC3, AC4 and intergenic region (IR) between BS and ToLCTWV-[Taiwan] were 98.6, 98.0, 98.0, 97.5, 96.3, 98.6 and 96.6%, respectively, while that of the six ORF-encoded proteins between BS and ToLCTWV-[Taiwan] were 97.7, 99.1, 97.5, 95.6, 91.8 and 99.0%, respectively. Phylogenetic analysis based on the DNA-A sequences has also indicated that BS is most closely related to ToLCTWV-[Taiwan], forming a branch with ToLCTWV-[Taiwan], Tomato leaf curl Guangdong virus and Tomato yellow leaf curl Guangdong virus. The above results demonstrate that BS is an isolate of ToLCTWV.

scholarly journals Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1550-1550 ◽  
Author(s):  
S. L. Shih ◽  
W. S. Tsai ◽  
S. K. Green ◽  
L. M. Lee
Keyword(s):  
International Committee ◽  
Tomato Leaf ◽  
Open Reading Frames ◽  
Specific Primers ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Two Samples ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmer's field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Molecular Characterization of a Begomovirus Associated with Tomato Leaf Curl Disease in Uganda

Plant Disease ◽  
2006 ◽  
Vol 90 (2) ◽  
pp. 246-246 ◽  
Author(s):  
S. L. Shih ◽  
S. K. Green ◽  
W. S. Tsai ◽  
C. Ssekyewa
Keyword(s):  
Pairwise Comparison ◽  
Tomato Leaf ◽  
Nucleotide Position ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Embl Accession ◽  
Tomato Leaf Curl ◽  
Sequence Identities ◽  
Leaf Curl

During the summer of 2003, leaf curl symptoms were observed in tomato (Lycopersicon esculentum) plantings in the Iganga District of Uganda. Begomoviral infection was suspected. Twelve symptomatic samples were collected. Begomoviral DNA was extracted and amplified using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4). The expected 1.4-kb PCR products were obtained from 11 of 12 samples. The 1.4-kb PCR product of one of the samples was cloned and sequenced. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,747 nucleotides (GenBank Accession No. DQ127170) and was found to contain seven predicted open reading frames (ORFs V1, V2, C1, C2, C3, C4, and C5). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and MegAlign (DNASTAR, Inc, Madison, WI) software was used for further comparisons. The DNA-A sequence of the virus associated with leaf curl of tomato from Uganda showed less than 79% sequence identity with cassava mosaic viruses from Uganda (GenBank/EMBL Accession Nos. AF126800, AF126802, AF126804, AF126806, and Z83257), the only begomoviruses from the country so far in the public domain. Highest sequence identity (83%) was with Tomato leaf curl Mayotte virus from Dembeni, Mayotte, Comoros Islands (ToLCYTV-[Dem], EMBL Accession No. AJ865341). Pairwise comparison with ToLCYTV-[Dem] showed 60, 88, 91, 82, 84, 86, and 80% sequence identities in the intergenic region, V2, V1, C1, C2, C3, and C4 ORFs, respectively. Only low sequence identities (ranging from 71 to 82%) were obtained with other tomato bego-moviruses reported from Africa (GenBank/EMBL Accession Nos. AF261885, AJ865337-AJ865340, AY044137-AY044139, AY502934, AY502936, AY594174, AY736854, and U73498). There was no evidence for the presence of DNA-B or DNA-beta using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. Detection of possible recombination was by RDP2 software (3) using DNA-A sequences of begomoviruses from Uganda and tomato begomoviruses from Africa. The DNA-A was found to contain a small recombinant fragment from ToLCYTV-[Dem] in the 411 to 969 nucleotide position with 92% sequence identity. Based on DNA-A sequence comparisons, the tomato leaf curl virus from Uganda most likely constitutes a distinct new begomovirus. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) D. P. Martin et al. Bioinformatics 21:260, 2005. (4) M. R. Rojas et al. Plant Dis.77:340, 1993.

scholarly journals First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1585-1585 ◽  
Author(s):  
M. K. Osei ◽  
R. Akromah ◽  
S. L. Shih ◽  
L. M. Lee ◽  
S. K. Green
Keyword(s):  
Molecular Characterization ◽  
Tomato Leaf ◽  
Begomovirus Species ◽  
Sequence Comparisons ◽  
Tomato Leaf Curl Disease ◽  
Sequence Identity ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato leaf curl disease is reported to be widespread in Ghana and to cause severe yield losses (4). So far, the causal agent has not been identified. Thirty-three tomato (Solanum lycopersicum L.) samples with symptoms such as curling, yellowing, small leaves, and stunting were collected from the Ashanti Region, the main tomato-production area in Ghana, including three samples from Akumandan in the autumn of 2007 and 30 samples from Kumasi in the spring of 2008. The observed leaf curl disease incidence in the farmer's field in Kumasi was approximately 75%. Viral DNAs were extracted from the 33 samples and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR with previously described primers (1,3). The expected 1.4-kb DNA-A begomovirus fragment was obtained from one of the samples from Akumadan and from 25 samples from Kumasi. DNA-B and DNA-beta were not detected by PCR. The 1.4-kb PCR products from all positive samples were cloned and sequenced. Sequence comparison by MegAlign software (DNASTAR, Inc., Madison, WI) showed three distinct virus groups. One isolate from each group was selected and specific primers were designed to complete the DNA-A sequence. The DNA-As of GH5-3 (group 1), GOTB2-2 (group 2), and GHK2 (group 3) isolates consisted of 2,803 (GenBank Accession No. EU350585), 2,794 (GenBank Accession No. EU847739), and 2,792 nt (GenBank Accession No. EU847740) respectively. All contain the geminiviral conserved nonanucleotide sequence TAATATTAC in the intergenic region and the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). BLASTn analysis was conducted with geminivirus sequences available in the GenBank database at National Center for Biotechnology Information (Bethesda, MD). Further sequence comparisons were performed by Clustal V algorithm of MegAlign software with the representative isolates of begomovirus species reported by Fauquet et al (2) and the sequences that showed high scores in BLASTn search. The DNA-A sequence of isolate GHK2 from Kumasi showed highest sequence identity (96.5%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accesssion No. AY502934). The DNA-A sequence of GH5-3 and GOTB2-2 isolates had 87.5% sequence identity with each other. Both had highest sequence identities of 76.7 and 77.6%, respectively, with Tomato leaf curl Antsiranana virus, Madagascar (GenBank Accession No. AM701764). They constitute two distinct begomovirus species based on DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity. The names Tomato leaf curl Ghana virus for isolate GH5-3 and Tomato leaf curl Kumasi virus for isolate BOTB2-2 are proposed, respectively. To our knowledge, this is the first report of molecular characterization of begomoviruses associated with tomato leaf curl disease in Ghana and of the presence of three distinct tomato begomoviruses. This presence should be considered for recommending or developing stable begomovirus resistant tomato cultivars for Ghana. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) D. Horna et al., eds. Online publication. Int. Food Policy Res. Inst. PBS Policy Brief 2, 2007.

scholarly journals Molecular Characterization of Tomato and Chili Leaf Curl Begomoviruses from Pakistan

Plant Disease ◽  
2003 ◽  
Vol 87 (2) ◽  
pp. 200-200 ◽  
Author(s):  
S. L. Shih ◽  
W. S. Tsai ◽  
S. K. Green ◽  
S. Khalid ◽  
I. Ahmad ◽  
...  
Keyword(s):  
Tomato Leaf ◽  
Nucleotide Identity ◽  
Common Region ◽  
Sequence Comparisons ◽  
North West ◽  
Sequence Identity ◽  
Begomovirus Isolate ◽  
The Common ◽  
Tomato Leaf Curl ◽  
Leaf Curl

Leaf curl or yellowing symptoms, typical of those caused by begomovirus infection, are commonly observed in chili (Capsicum annuum) and tomato (Lycopersicon esculentum) plantings in Pakistan. One chili sample with leaf curl symptoms was collected in 1998 in Multan (Punjab Province), and two tomato samples with leaf curl and yellowing symptoms were collected from Islamabad and Dargai (North West Frontier Province) in 2000 and 2001, respectively. Virus DNA was first amplified by polymerase chain reaction using the degenerate primer pair PAL1v1978/PAR1c715 (3). The expected 1.4-kb PCR products were obtained from the three samples. Based on the sequences of the 1.4-kb DNA products, specific primers were designed to complete each of the DNA-A sequences. Two primer pairs, DNABLC1/DNABLV2 and DNABLC2/DNABLV2, were used for the detection of DNA-B (2). The genome of the tomato leaf curl isolate from Islamabad contained a DNA-A of 2,739 nucleotides (GenBank Accession No. AF448059), a DNA-B of 2,728 nucleotides (GenBank Accession No. AY150304), and had 94% nucleotide identity in the common region. The genome of the tomato leaf curl isolate from Dargai contained a DNA-A of 2,740 nucleotides (GenBank Accession No. AF448058), a DNA-B of 2,686 nucleotides (GenBank Accession No. AY150305), and had 96% nucleotide identity in the common region. Each of the tomato isolates contained eight predicted open-reading frames (ORFs) (AV1, AV2, AV3, AC1, AC2, AC3, AC4, and AC5) in the DNA-A and two predicted ORFs (BV1 and BC1) in the DNA-B. The DNA-A nucleotide sequence identity of the Islamabad isolate and Dargai tomato isolate is 96% and that of DNA-B is 88%. Sequence comparisons with begomovirus sequences available in the GenBank sequence database showed that these two tomato virus isolates had the highest sequence identity with Tomato leaf curl New Delhi virus-Severe (GenBank Accession No. U15015) from northern India (more than 95% for DNA-A and less than 90% for DNA-B). The DNA-A of the virus associated with chili leaf curl from Pakistan (GenBank Accession No. AF336806) consists of 2,754 nucleotides, containing six predicted ORFs (AV1, AV2, AC1, AC2, AC3, and AC4). The chili virus was unrelated to the two tomato begomovirus isolates from Pakistan, with which it shares less than 75% nucleotide identity. Sequence comparisons show highest sequence identity (87%) with Tomato leaf curl Bangladesh virus (GenBank Accession No. AF188481). DNA-beta of 1.3 kb was detected in the chili begomovirus isolate using Beta01/Beta02 primers (1). There was no evidence for the presence of a DNA-B in the chili begomovirus isolate when tested by the two DNA-B specific primer pairs. Based on DNA sequence comparisons, the chili leaf curl virus from Pakistan, to our knowledge, constitutes a distinct, new monopartite begomovirus. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Tomato yellow leaf curl Thailand virus in Taiwan

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1363-1363 ◽  
Author(s):  
F.-J. Jan ◽  
S. K. Green ◽  
S. L. Shih ◽  
L. M. Lee ◽  
H. Ito ◽  
...  
Keyword(s):  
Satellite Dna ◽  
Positive Sample ◽  
Tomato Yellow Leaf ◽  
Tomato Leaf ◽  
Nucleotide Identity ◽  
Yellow Leaf ◽  
Viral Dna ◽  
First Report ◽  
Tomato Leaf Curl ◽  
Leaf Curl

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5′ATCGTGTTGGGAAGAGGTTT3′) and KD-PAC1 (5′GGAGAAAGCTCCCAAAGATT3′). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Tomato leaf curl Albatinah virus (ToLCABV) and its Associated Betasatellite Infecting Papaya in Oman

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 421-421 ◽  
Author(s):  
U. E. Ammara ◽  
A. Al-Shihi ◽  
I. Amin ◽  
A. M. Al-Sadi
Keyword(s):  
Coat Protein ◽  
Tomato Leaf ◽  
Transcription Activator ◽  
Sequence Identity ◽  
Sense Strand ◽  
Virion Sense ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Complementary Sense ◽  
Leaf Curl

Leaf curl disease with severe curling, vein darkening, and vein thickening was observed on papaya plants in a field in Qurayat district of Oman during December 2013. Disease incidence ranged from 50 to 70%, particularly in young papaya plants. The presence of a large population of whiteflies and symptoms observed on papaya plants suggested that the causal agent could be begomoviruses (family Geminiviridae) and associated satellites. Four leaf samples with mild and severe leaf curling were collected from the field. Total nucleic acid extracted from symptomatic and healthy plants using the CTAB method were used as a template to amplify circular DNAs using Φ29 DNA polymerase, and products were digested with restriction enzymes to identify fragments of 2.6 to 2.8 kb typical of geminiviruses. BamHI yielded fragments of ~2.8 and 1.4 kb when the digested products were resolved by electrophoresis on a 1% agarose gel. These fragments were cloned and sequenced using a primer walking strategy in both directions. Sequencing results confirmed the exact sizes of 1,303, 1,358, and 2,765 bp; the sequences were deposited in GenBank under the accession numbers HG969296, HG969297, and HG969260, respectively. BLAST results showed that the first two sequences are Tomato leaf curl betasatellite (ToLCB; isolates Pap-2 and Pap-3) showing 97% sequence identity with a previously reported ToLCB sequence (Accession No. KF229728). Both satellites encode a single gene in the complementary sense strand referred to as βC1, which showed 97% sequence identity to ToLCB (HE800551). The viral sequence (isolate Pap-6) showed four genes in the complementary sense (the replication-associated protein [Rep] gene, the transcription-activator protein [TrAP] gene, the replication-enhancer protein [REn] gene, and the C4 gene) and two genes (pre-coat protein [V2] and coat protein [CP]) in virion-sense (2). BLAST analysis showed 95.2% sequence identity to Tomato leaf curl Albatinah virus (ToLCABV; FJ956700), reported earlier to infect tomato in Oman (3). Amino acid sequence comparison of the four predicted proteins (Rep, TrAP, Ren, and C4) encoded by Pap-6 shared 95, 96, 100, and 100% sequence identity, whereas virion-sense proteins (V1 and V2) shared 99% sequence identity with ToLCABV (FJ956700). According to the recommendations of the International Committee on Taxonomy of Viruses, these results indicate that the virus identified in association with papaya leaf curl disease in Oman is a variant of ToLCABV (1). All infected samples showed the presence of ToLCABV, while no hybridization was observed in healthy control DNA using ToLCABV probe. These findings are indicative of the rapid spread of diseases involving Begomovirus and betasatellites, which often result in increased host range, as is evident from this study. References: (1) C. M. Fauquet et al. Arch. Virol. 148:405, 2003. (2) L. Hanley-Bowdoin et al. Crit. Rev. Plant Sci. 18:71, 1999. (3) A. J. Khan et al. Arch. Virol. 159:445, 2013.

Sign in / Sign up

Export Citation Format

Share Document