Molecular Characterization of Novel Cucurbit Aphid Borne Yellows Virus Strains Infecting Squash and Watermelon in India

The pathogen responsible for yellowing and downward rolling of leaves of squash and watermelon plants from Uttar Pradesh state, India, was identified as probably strains of Cucurbit aphid-borne yellows virus (CABYV) through RT-PCR using universal Polerovirus primers followed by sequencing. The full-length genome sequences of an isolate from squash (POL-SQ - 5650 nt) and one from watermelon (POL-WM - 5647nt) were determined by sequencing the products from RT-PCR with six sets of primers with overlapping products. Sequence comparison and phylogenetic analysis showed that these isolates had closest identity with a recombinant strain obtained between CABYV and Melon aphid-borne yellows virus (MABYV) reported from Taiwan infecting Luffa aegyptiaca (CABYV-R-TW82) rather than other Asian, American, or European isolates. The deduced amino acid sequences of the P0, P1 and P1-P2 proteins showed >10% variation, whereas the P3, P4 and P3-P5 proteins showed <10% variation when compared to the corresponding proteins of other strains of CABYV worldwide. Thus, according to the Polerovirus species demarcation threshold, these new sequences should be regarded as representing strains of a novel previously undescribed Polerovirus species. However, based on their sequence similarity and phylogenetic grouping with the recombinant strain from Taiwan we suggest these sequences represent recombinant strains of CABYV. These are the first full-length genome sequences for CABYV strains from India and this study adds watermelon as host for CABYV in India.

The begomovirus species Melon chlorotic leaf curl virus is composed of two highly divergent strains that differ in their genetic and biological properties

Since the early 1990s, squash production in Costa Rica has been affected by a whitefly-transmitted disease characterized by stunting and yellow mottling of leaves. The squash yellow mottle disease (SYMoD) was shown to be associated with a bipartite begomovirus, originally named squash yellow mild mottle virus (SYMMoV). It was subsequently established that SYMMoV is a strain of melon chlorotic leaf curl virus (MCLCuV), a bipartite begomovirus that causes a chlorotic leaf curl disease of melons in Guatemala. In the present study, the complete sequences of the DNA-A and DNA-B components of a new isolate of the strain MCLCuV-Costa Rica (MCLCuV-CR) were determined. Comparisons of full-length DNA-A sequences revealed 97% identity with a previously characterized isolate of MCLCuV-CR, and identities of 90 to 91% with those of isolates of the strain MCLCuV-Guatemala (MCLCuV-GT), which is below or at the current begomovirus species demarcation threshold of 91%. A more extensive analysis of the MCLCuV-CR and -GT sequences revealed substantial divergence in both components and different histories of recombination for the DNA-A components. The cloned full-length DNA-A and DNA-B components of this new MCLCuV-CR isolate were infectious and induced SYMoD in a range of squashes and in pumpkin, thereby fulfilling Koch’s postulates for this disease. However, in contrast to MCLCuV-GT, MCLCuV-CR induced mild symptoms in watermelon and no symptoms in melon and cucumber. Taken together, our results indicate that MCLCuV-CR and -GT have substantially diverged, genetically and biologically, and have evolved to cause distinct diseases of different cucurbit crops. Taxonomically, these viruses are at the strain/species boundary, but retain the designation as strains of Melon chlorotic leaf curl virus under current ICTV guidelines.

Characterization of a New Monopartite Begomovirus with a Betasatellite Associated with Leaf Curl, Yellow Vein, and Vein Enation in Hibiscus rosa-sinensis

A new begomovirus, tentatively named hibiscus yellow vein leaf curl virus (HYVLCV), was identified in Hibiscus rosa-sinensis plants showing symptoms of leaf curl, yellow vein, and vein enation on the undersides of the leaf in Taiwan. Sequence analysis of the full-length HYVLCV genome from the rolling cycle amplicon revealed a genome of 2,740 nucleotides that contains six open reading frames and a conserved sequence (5′-TAATATTAC-3′) commonly found in geminiviral genomes. HYVLCV shares the highest nucleotide identity (88.8%) with cotton leaf curl Multan virus (CLCuMuV) genome, which is lower than the criteria (91%) set for species demarcation in the genus Begomovirus. No begomoviral DNA-B was detected; however, a begomovirus-associated DNA betasatellite (DNA-β) was detected. The DNA-β (1,355 nucleotides) shares the highest nucleotide identity (78.6%) with malvastrum yellow vein betasatellite (MaYVB). Because the identity is slightly higher than the criteria (78%) set for the species demarcation threshold for a distinct DNA-β species, the DNA-β of HYVLCV reported in this study is considered the same species of MaYVB and tentatively named MaYVB-Hib. An expected 1,498-bp fragment was amplified with two HYVLCV-specific primers from 10 of 11 field-collected samples. Four independent amplicons were sequenced, revealing 100% nucleotide identity with the HYVLCV genome. Agroinoculation of a dimer of the infectious monopartite genome alone to Nicotiana benthamiana resulted in mild symptoms at 28 days postinoculation (dpi); coagroinoculation with the DNA-β satellite resulted in severe symptoms at 12 dpi. HYVLCV could be transmitted to healthy H. rosa-sinensis by grafting, resulting in yellow vein symptoms at 30 dpi.

Application of a sequence-based taxonomic classification method to uncultured and unclassified marine single-stranded RNA viruses in the order Picornavirales

Metagenomics has altered our understanding of microbial diversity and ecology. This includes its applications to viruses in marine environments that have demonstrated their enormous diversity. Within these are RNA viruses, many of which share genetic features with members of the order Picornavirales; yet, very few of these have been taxonomically classified. The only recognized family of marine RNA viruses is the Marnaviridae, which was founded based on discovery and characterization of the species Heterosigma akashiwo RNA virus. Two additional genera of marine RNA viruses, Labyrnavirus (one species) and Bacillarnavirus (three species), were subsequently defined within the order Picornavirales but not assigned to a family. We have defined a sequence-based framework for taxonomic classification of twenty marine RNA viruses into the family Marnaviridae. Using RNA-dependent RNA polymerase (RdRp) phylogeny and distance-based analyses, we assigned the genera Labyrnavirus and Bacillarnavirus to the family Marnaviridae and created four additional genera in the family: Locarnavirus (four species), Kusarnavirus (one species), Salisharnavirus (four species) and Sogarnavirus (six species). We used pairwise capsid protein comparisons to delineate species within families, with 75 per cent identity as the species demarcation threshold. The family displays high sequence diversities and Jukes–Cantor distances for both the RdRp and capsid genes, suggesting that the classified viruses are not representative of all of the virus diversity within the family and that there are many more extant taxa. Our proposed taxonomic framework provides a sound classification system for this group of viruses that will have broadly applicable principles for other viral groups. It is based on sequence data alone and provides a robust taxonomic framework to include viruses discovered via metagenomic studies, thereby greatly expanding the realm of viruses subject to taxonomic classification.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5′CCCGGATCCTCTAATTCATCCCT3′; IndC: 5′GACGGATCCCACATGTTTGCCA3′) was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.