scholarly journals First Report of Uromyces striatus on White Sweetclover in Kansas

Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1404-1404 ◽  
Author(s):  
D. L. Stuteville
Keyword(s):  
North America ◽  
Medicago Sativa ◽  
Plant Introduction ◽  
The United States ◽  
First Report ◽  
Medicago Lupulina ◽  
University Of Arizona ◽  
Causal Fungus ◽  
Pathogenicity Tests ◽  
Longitudinal Pattern

Rust was observed on leaves and stems of Melilotus alba Medik. plants in Riley County, Kansas, in November 1999. Rust reoccurred during the summers of 2000 and 2001. Uredinia were orange to reddish brown and predominately hypophyllous. Infected leaves wilted and abscised prematurely. Urediniospores were one-celled, globoid or broadly ellipsoid, and measured 20 to 25 × 18 to 22 μm. Walls were 1.0 to 1.2 μm thick, echinulate, and with three to five (mostly four) pores. Pores were equatorial, or nearly so, in approximately one half of the spores examined and scattered in the other half. Telia occurred in the fall, were sparse, amphigenous, exposed, and much darker than uredinia. Teliospores were single-celled, ovoid, subglobose or ellipsoidal, and measured 18 to 25 × 15 to 21 μm. Wall thickness was 1.3 to 2 μm. Walls had ridges approximately 1 μm wide, 2 μm apart, and arranged in a longitudinal pattern as shown in photographs of Uromyces striatus (2). Pedicels were hyaline, fragile, and short. Pathogenicity tests were conducted in growth chambers (4) with monouredinial isolate K-SC-R1 from M. alba. Pots containing plants of 80 USDA Plant Introduction (PI) core accessions representing 18 Melilotus spp. were evaluated. Total accessions tested per species were: 22 M. alba, 2 M. altissimus, 3 M. dentata, 2 M. elegans, 1 M. hirsutus, 4 M. indica, 2 M. infestus, 2 M. italica, 25 M. officinalis, 2 M. polonicus, 2 M. segetalis, 2 M. siculus, 2 M. speciosus, 2 M. spicatus, 1 M. suaveolens,2 M. sulcatus, 2 M. tauricus, and 2 M. wolgicus. Various amounts of rust developed on plants of 79 accessions; no plants of M. indica PI 234674 exhibited signs of rust. A host range study of an isolate of U. striatus from alfalfa (4) included these 18 Melilotus species; 10 were hosts. Therefore, the reactions of Medicago accessions to isolate K-SC-R1 were evaluated. These included nine alfalfa germ plasm sources representing the diversity in North American alfalfas and the cvs. Saranac and Moapa 69, which are commonly used susceptible controls in alfalfa rust evaluations. No rust resulted on any entry of Medicago sativa subsp. sativa. A few scattered, small, open uredinia occurred on plants of Medicago sativa subsp. falcata (‘WISFAL’ PI 560533). Of 11 Medicago lupulina PI accessions inoculated, rust resulted only on a few plants of PI 269926. All M. alba plants included as susceptible controls in all tests became heavily rusted. The causal fungus fits U. striatus Schroet. as described by uredinologists who disregard urediniospore pore position in this species. For example, illustrations of U. striatus urediniospores by Savulescu (3) show scattered pores, however, descriptions of U. striatus Schroet. in North America (1,2) specify equatorial pores. To my knowledge, this is the first report of scattered pores in U. striatus urediniospores in the United States. However, an examination of urediniospores from heavily rusted alfalfa plants collected in 2001 near Manhattan, KS and from isolate KR1 (4) also revealed urediniospores with variously distributed pores. U. striatus was reported on M. alba in Florida in 2001. References: (1) G. B Cummins. Rust Fungi on Legumes and Composites in North America. University of Arizona Press, Tucson, 1978. (2) J. A. Parmelee. Can. J. Bot. 40:491, 1962. (3) T. Savulescu. Monografia Uredinalelor din Republica Populara Romana. II. Acad. Repub. Pop. Rom. 1953. (4) D. Z. Skinner and D. L. Stuteville. Plant Dis. 79:456, 1995.

scholarly journals First Report of Anthracnose of Lentil Incited by Colletotrichum truncatum in Bulgaria

Plant Disease ◽  
1998 ◽  
Vol 82 (1) ◽  
pp. 128-128 ◽  
Author(s):  
W. J. Kaiser ◽  
M. Mihov ◽  
F. J. Muehlbauer ◽  
R. M. Hannan
Keyword(s):  
Severe Infection ◽  
Plant Introduction ◽  
The United States ◽  
Field Trials ◽  
Colletotrichum Truncatum ◽  
Low Frequencies ◽  
First Report ◽  
Pure Cultures ◽  
Pathogenicity Tests ◽  
Stem Lesions

In June 1992 and 1995, anthracnose of lentil (Lens culinaris Medik.) incited by Colletotrichum truncatum (Schwein.) Andrus & W. D. Moore was widespread in field trials at the Institute for Wheat and Sunflower ‘Dobroudja’ near General Toshevo in northeastern Bulgaria. Lesions on the leaves, stems, and pods were usually white to grayish on younger plants, often turning brown as plants matured. Severe infection usually resulted in dieback and/or death of plants. Acervuli containing spores and dark setae were observed within lesions, and conidia from the acervuli produced pure cultures of C. truncatum. Conidia were hyaline, onecelled, falcate to nearly straight with a prominent clear area in the center of highly granular cytoplasm, and measured 17.6 to 19.8 × 4.4 μm. C. truncatum was seed-borne in naturally infected lentil cv. Tadjikskaya 95 at low frequencies (<2%). Koch's postulates were fulfilled by inoculating the foliage of lentil cvs. Brewer and Pardina and reisolating the fungus from stem and petiole lesions. In pathogenicity tests, three isolates of C. truncatum from the foliage and seeds of lentil caused severe symptoms on inoculated lentil cvs. Brewer and Pardina, similar to those observed on diseased lentils in Bulgaria. The fungus also caused moderate symptoms on inoculated faba bean (Vicia faba L.) and pea (Pisum sativum L.), and light symptoms on inoculated chickpea (Cicer arietinum L.). In 1995, 258 USDA Plant Introduction (PI) accessions from the USDA lentil core collection were screened in replicated trials in northeastern Bulgaria and disease symptoms were observed in >90% of the lines. Anthracnose severity ranged from light to severe. A few accessions appeared to have acceptable levels of resistance to the disease. These included accessions from Iran (PI 431714 and 431717) and Spain (PI 533693). Also that year, C. truncatum was isolated from stem lesions of naturally infected bitter vetch (Vicia ervilia (L.) Willd.) at the Institute for Wheat and Sunflower ‘Dobroudja’. The disease in Bulgaria appears to be identical to one causing anthracnose of lentil in Canada (1) and the United States (2). This is the first report of C. truncatum causing anthracnose of lentil in Bulgaria. References: (1) R. A. A. Morrall. Plant Dis. 72:994, 1988. (2) J. R. Venette et al. Plant Dis. 78:1216, 1994.

scholarly journals First Report of Leaf Spot on Japanese Plum Caused by an Alternaria sp. in Korea

Plant Disease ◽  
2005 ◽  
Vol 89 (3) ◽  
pp. 343-343 ◽  
Author(s):  
Youngjun Kim ◽  
Hyang Burm Lee ◽  
Seung Hun Yu
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
The United States ◽  
Conidial Suspension ◽  
First Report ◽  
Japanese Plum ◽  
Leaf Spots ◽  
Causal Fungus ◽  
Pathogenicity Tests ◽  
Alternaria Sp

Japanese plum (Prunus salicina Lindley) is a deciduous tree in the family Rosaceae. In Korea, this plant is widely distributed in orchards as an important stone fruit as well as in gardens as an ornamental tree because of their abundant white blossoms. Every September to November since 2001, leaf spots were observed on Japanese plum in a garden in Cheongyang, Chungnam District, Korea. Early symptoms consisted of small, brown spots that were 2 to 5 mm in diameter. Later, the leaf lesions became circular or irregular, dark brown, expanded to 15 mm in diameter, and resulted in discoloration with necrosis on twisted leaves that was followed by defoliation. In November, older lesions sometimes appeared blackish brown as sporulation occurred on the lesions. The causal fungus was isolated from diseased leaves and cultured on potato dextrose agar. A culture has been placed in the CABI Herbarium (IMI Accession No. 387139). Conidial dimension averaged 34 × 12 μm. On the basis of morphological characteristics of conidia and conidiophores, the causal fungus was identified as a small-spored species of Alternaria as described by E. G. Simmons (1). Pathogenicity tests were conducted by inoculating slightly wounded and nonwounded leaves with a conidial suspension adjusted to 1 × 106 conidia/ml. Four leaves per each experiment were either wounded or not and inoculated with a spore suspension. The eight leaves were placed in a moist chamber at 25°C. After 6 to 10 days, small brown spots appeared on 87% of the wounded and nonwounded leaves. Control leaves sprayed with distilled water did not develop any symptoms. The causal fungus was consistently reisolated from the leaf spots. Results from pathogenicity tests were similar in a repeated test. It is possible that small-spored Alternaria spp. isolates are host specific (2). Eight Alternaria spp., including A. alternata, A. tenuis, A. tenuissima, and A. citri, have been found to cause black spot on fifteen Prunus spp. in China, Japan, Hong Kong, Libya, Mexico, Australia, and the United States (2). Further studies on the host-specific toxin production, geographical distribution, and host ranges for the species of Alternaria isolated from Japanese plum are in progress. To our knowledge, this is the first report of leaf spot on Japanese plum (P. salicina) caused by a small-spored Alternaria sp. in Korea. References: (1) E. G. Simmons. Mycotaxon 55:79, 1995. (2) K. Inoue and H. Nasu. J. Gen. Plant Pathol. 66:18, 2002.

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

scholarly journals First Report of a Leaf Spot Caused by Alternaria brassicae on the Invasive Weed Lepidium draba in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 846-846 ◽  
Author(s):  
A. J. Caesar ◽  
R. T. Lartey
Keyword(s):  
North America ◽  
Chinese Cabbage ◽  
Leaf Spot ◽  
The United States ◽  
Alternaria Brassicae ◽  
Voucher Specimen ◽  
First Report ◽  
Leaf Spots ◽  
Black Spots ◽  
Lepidium Draba

The exotic, rangeland weed Lepidium draba L., a brassicaceous perennial, is widely distributed in the United States. For example, Oregon contains 100,000 ha of land infested with L. draba (2). Because it is capable of aggressive spread and has the potential to reduce the value of wheat-growing land (4), it is the target of biological control research. The application of multiple pathogens has been advocated for control of other brassicaceous weeds, including the simultaneous application of biotrophic and necrotrophic pathogens (3). In pursuit of this approach, in 2007, we discovered the occurrence of leaf spots on approximately 90% of L. draba plants near Shepherd, MT, which were distinct from leaf lesions caused by Cercospora bizzozeriana (1). The lesions were initially tiny, black spots enlarging over time to become circular to irregular and cream-colored around the initial black spots and sometimes with dark brown borders or chlorotic halos. Conidia from the lesions were light brown, elongate and obclavate, produced singly from short conidia, with 8 to 12 transverse septa, and 2 to 6 longitudinal septa. The spore body measured 25 to 35 × 200 to 250 μm with a beak cell 42 to 100 μm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc. Leaf tissues bordering lesions were plated on acidified potato dextrose agar. Colonies on V8 and alfalfa seed agar were black with concentric rings, eventually appearing uniformly black after 10 to 14 days. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with a sequence of A. brassicae Strain B from mustard (GenBank Accession No. DQ156344). The nucleotide sequence has been assigned GenBank Accession No. FJ869872. For pathogenicity tests, aqueous spore suspensions approximately 105/ml were prepared from cultures grown at 20 to 25°C for 10 to 14 days on V8 agar and sprayed on leaves of three L. draba plants. Inoculated plants were enclosed in plastic bags and incubated at 20 to 22°C for 72 to 80 h. In addition, three plants of the following reported hosts of A. brassicae were inoculated: broccoli, canola, Chinese cabbage, collards, broccoli raab, kale, mustard greens, radish, rape kale, and turnip. Within 10 days, leaf spots similar to those described above developed on plants of radish, canola, Chinese cabbage, and turnip and A. brassicae was reisolated and identified. Control plants sprayed with distilled water remained symptomless. These inoculations were repeated and results were the same. To our knowledge, this is the first report of a leaf spot disease caused by A. brassicae on L. draba in North America. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) A. J. Caesar et al. Plant Dis. 93:108, 2009. (2) G. L. Kiemnec and M. L. McInnis. Weed Technol. 16:231, 2002. (3) A. Maxwell and J. K. Scott. Adv. Bot. Res. 43:143, 2005. (4) G. A. Mulligan and J. N. Findlay. Can. J. Plant Sci. 54:149, 1974.

scholarly journals First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1225-1225 ◽  
Author(s):  
T. S. Schubert ◽  
M. M. Dewdney ◽  
N. A. Peres ◽  
M. E. Palm ◽  
A. Jeyaprakash ◽  
...  
Keyword(s):  
North America ◽  
Sweet Orange ◽  
Black Spot ◽  
The United States ◽  
Yield Reduction ◽  
Rrna Gene ◽  
Specific Primers ◽  
Oatmeal Agar ◽  
First Report ◽  
Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

First Report of a 16SrI (Aster Yellows) Group Phytoplasma in Phlox in the United States

2016 ◽  
Vol 17 (3) ◽  
pp. 198-199
Author(s):  
Andrew E. Sathoff ◽  
Deepak Rajendran ◽  
Seth D. Wannemuehler ◽  
Katarina Sweeney ◽  
Fazal Manan ◽  
...  
Keyword(s):  
United States ◽  
North America ◽  
Flowering Time ◽  
Flower Color ◽  
The United States ◽  
Aster Yellows ◽  
First Report ◽  
Color Range ◽  
Small Grains ◽  
Herbaceous Perennial

Phlox are herbaceous perennial ornamentals native to North America grown for their flower color, range in flowering time, scent, and differing forms. Candidatus Phytoplasma asteris, first found to occur in Chinese asters, is spread by aster leafhoppers and in 2001 was reported to be a serious threat to phlox. There have been several reports of Ca. P. asteris in garlic and small grains in Minnesota. This is the first report of Candidatus Phytoplasma asteris in phlox in Minnesota and the United States. Accepted for publication 28 June 2016. Published 6 September 2016.

scholarly journals First Report of Phytophthora citrophthora on Penstemon barbatus in Italy

Plant Disease ◽  
2006 ◽  
Vol 90 (9) ◽  
pp. 1260-1260 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
D. Minerdi ◽  
M. L. Gullino
Keyword(s):  
Its Region ◽  
The United States ◽  
Phytophthora Species ◽  
Crown Rot ◽  
Pathogenicity Test ◽  
Phytophthora Citrophthora ◽  
First Report ◽  
Blastn Analysis ◽  
Root And Crown Rot ◽  
Pathogenicity Tests

Penstemon barbatus (Cav.) Roth (synonym Chelone barbata), used in parks and gardens and sometimes grown in pots, is a plant belonging to the Scrophulariaceae family. During the summers of 2004 and 2005, symptoms of a root rot were observed in some private gardens located in Biella Province (northern Italy). The first symptoms resulted in stunting, leaf discoloration followed by wilt, root and crown rot, and eventually, plant death. The diseased tissue was disinfested for 1 min in 1% NaOCl and plated on a semiselective medium for Oomycetes (4). The microorganism consistently isolated from infected tissues, grown on V8 agar at 22°C, produced hyphae with a diameter ranging from 4.7 to 5.2 μm. Sporangia were papillate, hyaline, measuring 43.3 to 54.4 × 26.7 to 27.7 μm (average 47.8 × 27.4 μm). The papilla measured from 8.8 to 10.9 μm. These characteristics were indicative of a Phytophthora species. The ITS region (internal transcribed spacer) of rDNA was amplified using primers ITS4/ITS6 (3) and sequenced. BLASTn analysis (1) of the 800 bp obtained showed a 100% homology with Phytophthora citrophthora (R. & E. Sm.) Leonian. The nucleotide sequence has been assigned GenBank Accession No. DQ384611. For pathogenicity tests, the inoculum of P. citrophthora was prepared by growing the pathogen on autoclaved wheat and hemp kernels (2:1) at 25°C for 20 days. Healthy plants of P. barbatus cv. Nano Rondo, 6 months old, were grown in 3-liter pots (one plant per pot) using a steam disinfested substrate (peat/pomix/pine bark/clay 5:2:2:1) in which 200 g of kernels per liter of substrate were mixed. Noninoculated plants served as control treatments. Three replicates were used. Plants were maintained at 15 to 20°C in a glasshouse. The first symptoms, similar to those observed in the gardens, developed 21 days after inoculation, and P. citrophthora was consistently reisolated from infected plants. Noninoculated plants remained healthy. The pathogenicity test was carried out twice with similar results. A nonspecified root and crown rot of Penstemon spp. has been reported in the United States. (2). To our knowledge, this is the first report of P. citrophthora on P. barbatus in Italy as well as in Europe. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997 (2) F. E. Brooks and D. M. Ferrin. Plant Dis. 79:212, 1995. (3) D. E. L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (4) H. Masago et al. Phytopathology 67:425, 1977.

scholarly journals First Report of Sclerotinia minor Infecting Ipomoea hederacea and I. coccinea in Texas

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 482-482 ◽  
Author(s):  
J. E. Woodward ◽  
M. A. Batla ◽  
P. A. Dotray ◽  
T. A. Wheeler ◽  
T. A. Baughman
Keyword(s):  
Weed Management ◽  
Tap Water ◽  
The United States ◽  
Plant Diseases ◽  
Weed Species ◽  
Sclerotinia Minor ◽  
Ipomoea Hederacea ◽  
First Report ◽  
Sclerotinia Blight ◽  
Pathogenicity Tests

Sclerotinia blight, caused by the soilborne fungus Sclerotinia minor Jagger, is a major disease of peanut (Arachis hypogaea L.) in parts of west Texas. Previous reports have indicated that annual weed species may serve as collateral hosts for S. minor (2). Several Ipomoea spp. are commonly found in peanut fields throughout the region. In September of 2007, Ipomoea hederacea and I. coccinea plants with bleached, shredded stems, and signs of black sclerotia were collected from a field known to be infested with S. minor. Symptomatic stem sections were rinsed in tap water, surface disinfested in 0.5% sodium hypochlorite for 1 min, air dried, and plated on potato dextrose agar (PDA). Pure cultures of S. minor consisting of white, fluffy mycelia and small (<2 mm), black, irregular sclerotia were consistently recovered. Pathogenicity tests were conducted by wound-inoculating healthy I. hederacea and I. coccinea transplants (n = 3) with agar plugs obtained from the edges of actively growing S. minor cultures. Plants were incubated in a dew chamber at 20°C and 95% relative humidity for 5 days. Plants inoculated with sterile PDA plugs served as controls (n = 3). A similar test was conducted using the susceptible peanut cultivar Flavorunner 458. Characteristic symptoms of Sclerotinia blight (3) were observed on all inoculated weed and peanut plants; whereas, the controls remained healthy. Pathogenicity tests were repeated with similar results. Cultures of S. minor were obtained from all symptomatic tissues, fulfilling Koch's postulates. These results indicate that I. hederacea and I. coccinea are additional hosts of S. minor and that sclerotia produced on infected plants can significantly augment soil inoculum. S. minor has been observed to infect I. batatas seedlings in New Jersey (1); however, this to our knowledge is the first report of S. minor infecting Ipomoea spp. in Texas. Therefore, weed management should inevitability be a part of disease management strategies for the control of Sclerotinia blight in peanut. References: (1) Anonymous. Index of Plant Diseases in the United States. USDA Handb. No. 165, 1960. (2) J. E. Hollowell et al. Plant Dis. 87:197, 2003. (3) D. M. Porter and H. A. Melouk. Sclerotinia blight. Page 34 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathologicial Society, St. Paul, MN, 1997.

scholarly journals First Report of Web Blight on Yellow-Sage (Lantana camara) Caused by Rhizoctonia solani in Europe

Plant Disease ◽  
2003 ◽  
Vol 87 (7) ◽  
pp. 875-875 ◽  
Author(s):  
A. Garibaldi ◽  
A. Minuto ◽  
D. Bertetti ◽  
R. Nicoletti ◽  
M. L. Gullino
Keyword(s):  
United States ◽  
Rhizoctonia Solani ◽  
The United States ◽  
The Philippines ◽  
Lantana Camara ◽  
First Report ◽  
Leaf Spots ◽  
Entire Plant ◽  
Pathogenicity Tests ◽  
Web Blight

Lantana camara is increasingly grown in northern Italy as a potted plant and contributes to the diversification of offerings in the ornamental market. During the spring of 2001, selections of L. camara cuttings growing at a commercial farm located at Albenga (Riviera coast) exhibited tan leaf spots of irregular size and shape. Spots were at first isolated, 4 to 8 mm in diameter, and later coalesced and affected the entire plant. Heavily infected leaves, stems, and branches became blighted and were killed. Infected rooted cuttings also eventually died. Diseased cuttings showed a progressive reduction (to less than 20%) in rooting ability. Isolations from infected leaves and stems on potato dextrose agar (PDA), supplemented with 100 mg/liter of streptomycin sulphate, consistently yielded a fungus with mycelial and cultural characteristics resembling Rhizoctonia solani. The fungal isolates were further characterized as R. solani Kühn AG-4 based on hyphal anastomoses with several AG-4 tester isolates. Pathogenicity tests were performed by placing 5-day-old-fungal mycelial plugs, grown on PDA, at the base of five healthy yellow-sage stems and holding plants in a dew chamber at 18 to 22°C. After 2 days, foliage blight appeared on leaves of inoculated plants, and after 3 days, stems also became infected and entire plants wilted. Five noninoculated plants remained healthy. The fungal pathogen was reisolated from all inoculated plants. R. solani has been observed on L. camara in the United States (1) and the Philippines (2). To our knowledge, this is the first report of R. solani on L. camara in Europe. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) F. T. Orillo and R. B. Valdez. Philipp. Agric. A. 42:292, 1958.

scholarly journals First Report of Postharvest Fruit Rot in Persimmon Caused by Phacidiopycnis washingtonensis in Italy

Plant Disease ◽  
2010 ◽  
Vol 94 (6) ◽  
pp. 788-788 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
M. T. Amatulli ◽  
M. L. Gullino
Keyword(s):  
United States ◽  
Its Region ◽  
The United States ◽  
Fruit Rot ◽  
Diospyros Kaki ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
First Report ◽  
Pathogenicity Tests ◽  
Phacidiopycnis Washingtonensis

Persimmon (Diospyros kaki L.) is widely grown in Italy, the leading producer in Europe. In the fall of 2009, a previously unknown rot was observed on 3% of fruit stored at temperatures between 5 and 15°C in Torino Province (northern Italy). The decayed area was elliptical, firm, and appeared light brown to dark olive-green. It was surrounded by a soft margin. The internal decayed area appeared rotten, brown, and surrounded by bleached tissue. On the decayed tissue, black pycnidia that were partially immersed and up to 0.5 mm in diameter were observed. Light gray conidia produced in the pycnidia were unicellular, ovoid or lacriform, and measured 3.9 to 6.7 × 2.3 to 3.5 (average 5.0 × 2.9) μm. Fragments (approximately 2 mm) were taken from the margin of the internal diseased tissues, cultured on potato dextrose agar (PDA), and incubated at temperatures between 23 and 26°C under alternating light and darkness. Colonies of the fungus initially appeared ash colored and then turned to dark greenish gray. After 14 days of growth, pycnidia and conidia similar to those described on fruit were produced. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced. BLAST analysis (1) of the 502-bp segment showed a 100% similarity with the sequence of Phacidiopycnis washingtonensis Xiao & J.D. Rogers (GenBank Accession No. AY608648). The nucleotide sequence has been assigned the GenBank Accession No. GU949537. Pathogenicity tests were performed by inoculating three persimmon fruits after surface disinfesting in 1% sodium hypochlorite and wounding. Mycelial disks (10 mm in diameter), obtained from PDA cultures of one strain were placed on wounds. Three control fruits were inoculated with plain PDA. Fruits were incubated at 10 ± 1°C. The first symptoms developed 6 days after the artificial inoculation. After 15 days, the rot was very evident and P. washingtonensis was consistently reisolated. Noninoculated fruit remained healthy. The pathogenicity test was performed twice. Since P. washingtonensis was first identified in the United States on decayed apples (2), ‘Fuji’, ‘Gala’, ‘Golden Delicious’, ‘Granny Smith’, ‘Red Chief’, and ‘Stark Delicious’, apple fruits also were artificially inoculated with a conidial suspension (1 × 106 CFU/ml) of the pathogen obtained from PDA cultures. For each cultivar, three surface-disinfested fruit were wounded and inoculated, while three others served as mock-inoculated (sterile water) controls. Fruits were stored at temperatures ranging from 10 to 15°C. First symptoms appeared after 7 days on all the inoculated apples. After 14 days, rot was evident on all fruit inoculated with the fungus, and P. washingtonensis was consistently reisolated. Controls remained symptomless. To our knowledge, this is the first report of the presence of P. washingtonensis on persimmon in Italy, as well as worldwide. The occurrence of postharvest fruit rot on apple caused by P. washingtonensis was recently described in the United States (3). In Italy, the economic importance of the disease on persimmon fruit is currently limited, although the pathogen could represent a risk for apple. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) Y. K. Kim and C. L. Xiao. Plant Dis. 90:1376, 2006. (3) C. L. Xiao et al. Mycologia 97:473, 2005.

Sign in / Sign up

Export Citation Format

Share Document