In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.
Surveying for Virus-vectoring Nematodes in Container-grown Blueberry Plants in Oregon
