scholarly journals Genome sequence of the corn leaf aphid (Rhopalosiphum maidis Fitch)

2018 ◽  
Author(s):  
Wenbo Chen ◽  
Sara Shakir ◽  
Mahdiyeh Bigham ◽  
Zhangjun Fei ◽  
Georg Jander

AbstractBackgroundThe corn leaf aphid (Rhopalosiphum maidis Fitch) is the most economically damaging aphid pest on maize (Zea mays), one of the world’s most important grain crops. In addition to causing direct damage due to the removal of photoassimilates, R. maidis transmits several destructive maize viruses, including Maize yellow dwarf virus, Barley yellow dwarf virus, Sugarcane mosaic virus, and Cucumber mosaic virus.FindingsA 326-Mb genome assembly of BTI-1, a parthenogenetically reproducing R. maidis clone, was generated with a combination of PacBio (208-fold coverage) and Illumina sequencing (80-fold coverage), which contains a total of 689 contigs with an N50 size of 9.0 Mb. The contigs were further clustered into four scaffolds using the Phase Genomics Hi-C interaction maps, consistent with the commonly observed 2n = 8 karyotype of R. maidis. Most of the assembled contigs (473 spanning 321 Mb) were successfully orientated in the four scaffolds. The R. maidis genome assembly captured the full length of 95.8% of the core eukaryotic genes, suggesting that it is highly complete. Repetitive sequences accounted for 21.2% of the assembly, and a total of 17,647 protein-coding genes were predicted in the R. maidis genome with integrated evidence from ab initio and homology-based gene predictions and transcriptome sequences generated with both PacBio and Illumina. An analysis of likely horizontally transferred genes identified two from bacteria, seven from fungi, two from protozoa, and nine from algae.ConclusionsA high-quality R. maidis genome was assembled at the chromosome level. This genome sequence will enable further research related to ecological interactions, virus transmission, pesticide resistance, and other aspects of R. maidis biology. It also serves as a valuable resource for comparative investigation of other aphid species.

2009 ◽  
Vol 10 (1) ◽  
pp. 14 ◽  
Author(s):  
Mary Burrows ◽  
Gary Franc ◽  
Charlie Rush ◽  
Tamla Blunt ◽  
Dai Ito ◽  
...  

Field surveys in 2008 determined the prevalence and diversity of viruses present in the Great Plains wheat crops. Symptomatic plants (n = 754) in nine states were tested for Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV, formerly known as High Plains virus), Triticum mosaic virus (TriMV), Barley yellow dwarf virus-PAV (BYDV-PAV), and Cereal yellow dwarf virus-RPV (CYDV-RPV), using indirect ELISA. Virus prevalence varied greatly, with average frequency of detection highest for WSMV (47%), followed by WMoV (19%), TriMV (17%), BYDV-PAV (7%), and lowest for CYDV-RPV (2%). Most positive plant samples (37%) had one virus present, with decreasing frequencies for co-infection by two (19%), three (5%), or four viruses (1%). TriMV was detected for the first time in Colorado, Nebraska, Oklahoma, South Dakota, Texas, and Wyoming. WMoV was identified for the first time in Montana and Wyoming. Chlorotic streaks were more frequently associated with WSMV, WMoV, and TriMV (R = 0.166 to 0.342; P < 0.05), and stunting was more frequently associated with WMoV (R = 0.142; P = 0.004) or TriMV (R = 0.107; P = 0.033) than WSMV. Symptom severity did not increase with co-infection as compared to single virus infections, with the exception of plants co-infected with mite transmitted viruses in Texas. Accepted for publication 1 May 2009. Published 6 July 2009.


Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.


Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 313-317 ◽  
Author(s):  
Andrew Milgate ◽  
Dante Adorada ◽  
Grant Chambers ◽  
Mary Ann Terras

Winter cereal viruses can cause significant crop losses; however, detailed knowledge of their occurrence in New South Wales, Australia is very limited. This paper reports on the occurrence of Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV), Barley yellow dwarf virus (BYDV), Cereal yellow dwarf virus (CYDV), and their serotypes between 2006 and 2014. Detection of WMoV is confirmed in eastern Australia for the first time. The BYDV and CYDV 2014 epidemic is examined in detail using 139 samples of wheat, barley, and oat surveyed from southern New South Wales. The presence of virus was determined using enzyme-linked immunosorbent assays. The results reveal a high frequency of the serotype Barley yellow dwarf virus - MAV as a single infection present in 27% of samples relative to Barley yellow dwarf virus - PAV in 19% and CYDV in 14%. Clear differences emerged in the infection of different winter cereal species by serotypes of BYDV and CYDV. These results are contrasted to other Australian and international studies.


2011 ◽  
pp. 52-55
Author(s):  
Melinda Apró ◽  
Mária Papp ◽  
Eszter Cseh ◽  
Richard Gáborjányi ◽  
József Horváth ◽  
...  

The past years cereal diseases, including the virus diseases have been increased in Hungary as well as worldwide. The aim of our work was to survey the virus infection of South Hungarian wheat fields. Leaf samples were collected in Szeged at the experimental farm of Cereal Research Nonprofit Co., in April and Junes of 2009 and 2010. DAS ELISA tests were carried out using Loewe antisera of Brome mosaic virus (BMV), Barley yellow dwarf virus (BYDV), Barley stripe mosaic virus (BSMV), Brome streak mosaic virus (BStMV), Wheat dwarf virus (WDV), and Wheat streak mosaic virus (WSMV) and measured with Labsystem Multiscan RC Elisa reader at 405nm. In the samples of 2009 the Wheat dwarf and Wheat streak mosaic viruses were dominated. It was also significant the appearance of the. Barley yellow dwarf virus. 2010. was favourable for the spread of the virus vectors, therefore the incidence of virus diseases increased.


2020 ◽  
Vol 21 (4) ◽  
pp. 317-320
Author(s):  
Nathan Kleczewski ◽  
Venkataramana Chapara ◽  
Carl A. Bradley

Field surveys in 2009, 2010, 2011, 2019, and 2020 determined the incidence and diversity of viruses present in fields of soft red winter wheat (Triticum aestivum) in Illinois. In addition, the putative presence of the bacterial mosaic pathogen, Clavibacter michiganensis subsp. tessellarius (Cmt), was evaluated. A total of 341 fields were sampled across years, and plants were tested for barley yellow dwarf virus (BYDV-PAV; BYDV-MAV), barley stripe mosaic virus (BSMV), brome mosaic virus (BMV), cereal yellow dwarf virus (CYDV-RPV), High Plains virus (HPV), Potyvirus group (POTY), soil-borne wheat mosaic virus (SBWMV), tobacco mosaic virus (TMV), wheat spindle streak mosaic virus (WSSMV), wheat streak mosaic virus (WSMV), and Cmt using ELISA. Average field incidence across years varied by virus with BYDV-PAV (22%), WSSMV (16%), CYDV-RPV (7%), WSMV (3%), and HPV (0.5%) detected in samples. The bacterial mosaic pathogen (Cmt), or potentially a related species of Clavibacter, was detected the most frequently in each year, with an average incidence of 77%. The consistent detection of Cmt warrants further study to determine the nature of the organisms associated with positive Cmt tests and their role in Illinois wheat production systems.


Sign in / Sign up

Export Citation Format

Share Document