scholarly journals Detection of Porcine Adulteration in Cosmetic Cream Formulation via TaqMan Probe Real-Time Polymerase Chain Reaction.

2019 ◽  
Vol 7 (4.14) ◽  
pp. 112
Author(s):  
S S Abd-Gani ◽  
S Mustafa ◽  
M N Mohd Desa ◽  
N F Khairil Mokhtar ◽  
U K Hanapi ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
18S Rrna ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Total Recovery ◽  
Detection Assay ◽  
Oil In Water ◽  
Total Dna ◽  
Polymerase Chain

The identification of  lard adulterated in cosmetic cream using TaqMan probe real-time Polymerase Chain Reaction was developed in this research. The laboratory prepared cream was formulated with oil in water (o/w) emulsion with the adulteration of 1%, 3% and 5% of lard (w/w). The total DNA from lard-adulterated cosmetic cream was successfully extracted. The detection assay targeting different gene; universal 18S rRNA and porcine-specific multiple porcine repetitive element (MPRE) which employed with the TaqMan probe. This study targeting 187 bp of amplicons for 18S rRNA while 99 bp of amplicons for Porcine-specific probes. A comparison of quantification cycle (Cq) with prior to percentage of adulteration were detected. Lard-adulterated cream was amplified for 18S rRNA while no detection was detected for Porcine-specific probes. The Cq value obtained might be vary as proposed by the hypothesis depending on the total recovery of extracted DNA from the lard-adulterated cream.  

Phylogeny of Canadian ergot fungi and a detection assay by real-time polymerase chain reaction

Mycologia ◽  
2019 ◽  
Vol 111 (3) ◽  
pp. 493-505 ◽  
Author(s):  
Parivash Shoukouhi ◽  
Carmen Hicks ◽  
Jim G. Menzies ◽  
Zlatko Popovic ◽  
Wen Chen ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Chain Reaction ◽  
Detection Assay ◽  
Polymerase Chain

scholarly journals Deteksi Plasmodium falciparum dengan menggunakan metode real-time polymerase chain reaction di daerah Likupang dan Bitung

2016 ◽  
Vol 4 (1) ◽  
Author(s):  
David C. Tooy ◽  
Janno B. Bernadus ◽  
Angle Sorisi
Keyword(s):  
Polymerase Chain Reaction ◽  
Plasmodium Falciparum ◽  
Real Time ◽  
Real Time Pcr ◽  
18S Rrna ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Negative Results ◽  
Pcr Method ◽  
Polymerase Chain

Abstract: Malaria is one of the most important parasitic disease which is caused by Plasmodium spp. There are approximately 1,2 billion people in the world with high risk of getting malaria. Plasmodium falciparum (P. falciparum) is the cause of tropical malaria or falciparum malaria, and is responsible for most of the mortality rate. Currently, real-time polymerase chain reaction (RT-PCR) is being studied as an alterative of conventional malarian examination. Mangold et al reported that RT-PCR have 94.1% sensitivity and 100% specificity compared to microscopic examination in detecting P. falciparum. The aim of this research is to detect the presence of P. falciparum using RT-PCR in Likupang and Bitung region. This research were using descriptive design to find out the capability of real-time PCR method to detect P. falciparum in Likupang dan Bitung region. The researcher have examined 71 samples which are fulfill the research sample’s criteria. Postive results of P. falciparum found in 18 samples (25,3%) and negative results in 53 samples (74,6%) of total 71 samples with using RT-PCR. No positive results were found in samples from Likupang. There are positive result of P. falciparum in samples from Bitung. It is concluded that RT-PCR method can detect the presence of P. falciparum from the samples obtained from Likupang and Bitung based on the presence of its DNA. This detection efford is done by using 18S rRNA as target gene and ajust specific temperature on the RT-PCR instrument.Keywords: Plasmodium falciparum, Real-time Polymerase Chain Reaction (PCR), DetectionAbstrak: Malaria merupakan salah satu penyakit penting yang disebabkan oleh parasit Plasmodium spp. Kira-kira 1,2 miliar penduduk dunia memiliki risiko tinggi untuk mendapat malaria. Di Indonesia sendiri, terdapat 343.527 kasus terkonfirmasi dan 45 kematian karena malaria. Plasmodium falciparum (P. Falciparum) merupakan penyebab dari malaria tropika atau malaria falsiparum, dan bertanggung jawab atas sebagian besar angka mortalitas. Saat ini Real-Time Polymerase Chain Reaction (RT-PCR) telah banyak diteliti sebagai alternatif dari pemeriksaan malaria. Mangold dkk melaporkan bahwa real-time PCR memiliki nilai sensitivitas 94,1% dan nilai spesifisitas 100% terhadap pemeriksaan mikroskopis dalam mendeteksi P. falciparum. Penelitian bertujuan untuk mendeteksi P. falciparum dengan menggunakan RT-PCR di daerah Likupang dan Bitung. Penelitian ini menggunakan rancangan penelitian deskriptif untuk mengetahui kemampuan metode real-time PCR dalam mendeteksi P. falciparum di daerah Likupang dan Bitung. Tujuan penelitian ini ialah untuk mendeteksi keberadaan P. falciparum dengan menggunakan metode real-time PCR di daerah Likupang dan Bitung. Peneliti memeriksa 71 sampel darah yang memenuhi kriteria sampel penelitian. Hasil positif P. falciparum ditemukan pada 18 sampel (25,3 %) dan hasil negatif pada 53 sampel (74,6 %) dari total 71 sampel dengan menggunakan RT-PCR. Tidak ditemukannya hasil positif P. falciparum pada sampel dari Likupang. Ditemukan hasil positif P. falciparum pada sampel dari Bitung. Simpulan: Metode RT-PCR dapat mendeteksi P. falciparum berdasarkan keberadaan DNA-nya pada sampel yang diperoleh dari daerah Likupang dan Bitung. Deteksi ini berhasil dilakukan dengan menggunakan 18S rRNA sebagai gen target dan pengaturan suhu tertentu pada instrument RT-PCR.Kata kunci: P. falciparum, Real-time Polymerase Chain Reaction (PCR), Detection

scholarly journals Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

2017 ◽  
Vol 86 (4) ◽  
pp. 317-323
Author(s):  
Milena Alicja Stachelska
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Yersinia Enterocolitica ◽  
Meat Products ◽  
Taqman Probe ◽  
Pork Meat ◽  
Chain Reaction ◽  
Microbial Risk ◽  
Polymerase Chain

The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detectYersinia enterocoliticastrains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg ofYersinia enterocoliticain pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenicYersinia enterocoliticastrains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

Real-time quantifications of dominant anaerobes in an upflow reactor by polymerase chain reaction using a TaqMan probe

2008 ◽  
Vol 57 (11) ◽  
pp. 1851-1855 ◽  
Author(s):  
D. W. Liang ◽  
T. Zhang ◽  
H. H. P. Fang
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Thermophilic Bacteria ◽  
Upflow Anaerobic Sludge Blanket ◽  
Taqman Probe ◽  
Uasb Reactor ◽  
Anaerobic Sludge ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Anaerobic Sludge Blanket

This study was conducted to demonstrate the application of quantitative real-time polymerase chain reaction (qRT-PCR) for the quantification of dominant bacteria in an anaerobic reactor using a designed TaqMan probe. A novel group of uncultured thermophilic bacteria affiliated with Thermotogales was first found in a phenol-degrading sludge from a 55°C upflow anaerobic sludge blanket (UASB) reactor, which effectively removed 99% of phenol at loading of 0.51 g-phenol l−1 d−1 h of hydraulic retention. A TaqMan probe was then designed targeting this group of Thermotogales affiliated bacteria (TAB), and used to monitor its concentration in the reactors. Results showed that the TAB population in the 55°C reactor increased proportional to the phenol degrading rate. Results also showed that the TAB population ranged 3.5–9.9% in the 55°C phenol-degrading sludge, but only 0.0044% in the 37°C sludge and 0.000086% in the 26°C sludge.

A multiplatform real-time polymerase chain reaction detection assay for Vibrio cholerae

2009 ◽  
Vol 65 (3) ◽  
pp. 339-344 ◽  
Author(s):  
Katja A. Koskela ◽  
Pirjo Matero ◽  
Janet M. Blatny ◽  
Else M. Fykse ◽  
Jaran Strand Olsen ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Vibrio Cholerae ◽  
Real Time ◽  
Polymerase Chain Reaction Detection ◽  
Chain Reaction ◽  
Detection Assay ◽  
Polymerase Chain
Sign in / Sign up

Export Citation Format

Share Document