Comparative Study of Real-Time PCR (TaqMan Probe and Sybr Green), Serological Techniques (ELISA, IFA and DAT) and Clinical Signs Evaluation, for the Diagnosis of Canine Leishmaniasis in Experimentally Infected Dogs

Canine leishmaniasis (CanL) diagnosis is not fully resolved. Currently, two specific methodologies are in continuous development, the detection of the parasite DNA or RNA in target organs and the detection of specific antibodies against Leishmania sp. For a correct diagnosis, it has been shown that the joint use of this type of test is necessary. In this work, a Sybr Green and a TaqMan Probe based on real time PCRs (qPCR) was performed for the detection of Leishmania sp. in order to correlate the results with clinicopathological and serological evaluations (IFA, ELISA and DAT) to propose an optimal biological sample to be used to detect the parasite in both early and late stages of the infection. A total of four samples were processed: conjunctival swabs, popliteal lymph node aspirates, bone marrow aspirates, and peripheral blood from experimentally infected dogs belonging to a larger study. Our results indicated that a single non-invasive sample (conjunctival swab) and the application of both types of qPCR would be reliable for determining Leishmania infection as well as the disease stage in dogs, thus avoiding bone marrow, lymph node aspirate or blood samples collection.

Association of IL-9, IL-10, and IL-17 Cytokines With Hepatic Fibrosis in Human Schistosoma mansoni Infection

This is a case series study to evaluate immunological markers associated with schistosomiasis advanced fibrosis, including 69 patients from an endemic area from the State of Sergipe and from the Hepatology Service of the University Hospital in Sergipe, Brazil. Hepatic fibrosis was classified based on Niamey protocol for ultrasonography (US). Immune response to Schistosoma mansoni antigens was evaluated by stimulating peripheral blood mononuclear cells (PBMCs) from these patients with either adult worm (SWAP—10 μg/ml) or egg (SEA—10 μg/ml) antigens or purified protein derivative of turberculin (PPD—10 μg/ml) or phytohemagglutinin (PHA—1 μg/ml) for 72 h. The levels of IFN-γ, TNF-α, IL-5, IL-10, and IL-17 were measured in these supernatants by ELISA and IL-9 by Luminex. Single nucleotide polymorphisms in IL-17, IL10, and CD209 genes were genotyped using TaqMan probe by qPCR. Higher levels of IL-9, IL-10, and IL-17 were found in PBMC supernatants of patients with advanced hepatic fibrosis. Direct correlations were detected between IL-9 and IL-17 levels with US spleen sizes, portal vein diameters, and periportal thickening. The CD209 rs2287886 AG polymorphism patients produce higher IL-17 levels. Together, these data suggest a role of these cytokines in the immunopathogenesis of advanced fibrosis in human schistosomiasis.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR. Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

A Novel Bunyavirus Discovered in Oriental Shrimp (Penaeus chinensis)

Herein, we describe a novel bunyavirus, oriental wenrivirus 1 (OWV1), discovered in moribund oriental shrimp (Penaeus chinensis) collected from a farm in China in 2016. Like most bunyaviruses, OWV1 particles were enveloped, spherical- to ovoid-shaped, and 80–115 nm in diameter. However, its genome was found to comprise four segments of (-)ssRNA. These included an L RNA segment (6,317 nt) encoding an RNA-directed RNA polymerase (RdRp) of 2,052 aa, an M RNA segment (2,978 nt) encoding a glycoprotein precursor (GPC) of 922 aa, an S1 RNA segment (1,164 nt) encoding a nucleocapsid (N) protein of 243 aa, and an S2 RNA segment (1,382 nt) encoding a putative non-structural (NSs2) protein of 401 aa. All the four OWV1 RNA segments have complementary terminal decanucleotides (5′-ACACAAAGAC and 3′-UGUGUUUCUG) identical to the genomic RNA segments of uukuviruses and similar to those of phleboviruses and tenuiviruses in the Phenuiviridae. Phylogenetic analyses revealed that the RdRp, GPC, and N proteins of OWV1 were closely related to Wēnzhōu shrimp virus 1 (WzSV-1) and Mourilyan virus (MoV) that infect black tiger shrimp (P. monodon). Phylogenetic analyses also suggested that OWV1 could be classified into a second, yet to be established, species of the Wenrivirus genus in the Phenuiviridae. These wenriviruses also clustered with Wenling crustacean virus 7 from shrimps and bunya-like brown spot virus from white-clawed crayfish. Of note there were no homologs of the NSs2 of OWV1 and MoV/WzSV-1 in GenBank, and whether other crustacean phenuiviruses also possess a similar S2 RNA segment warrants further investigation. In addition, we established a TaqMan probe-based reverse-transcription quantitative PCR method for detection of OWV1, and it was detected as 1.17 × 102—1.90 × 107 copies/ng-RNA in gills of 23 out of 32 P. chinensis samples without an obvious gross sign. However, the discovery of OWV1 highlights the expanding genomic diversity of bunyaviruses.

Universal probe-based intermediate primer-triggered qPCR (UPIP-qPCR) for SNP genotyping

Background The detection and identification of single nucleotide polymorphism (SNP) is essential for determining patient disease susceptibility and the delivery of medicines targeted to the individual. At present, SNP genotyping technology includes Sanger sequencing, TaqMan-probe quantitative polymerase chain reaction (qPCR), amplification-refractory mutation system (ARMS)-PCR, and Kompetitive Allele-Specific PCR (KASP). However, these technologies have some disadvantages: the high cost of development and detection, long and time consuming protocols, and high false positive rates. Focusing on these limitations, we proposed a new SNP detection method named universal probe-based intermediate primer-triggered qPCR (UPIP-qPCR). In this method, only two types of fluorescence-labeled probes were used for SNP genotyping, thus greatly reducing the cost of development and detection for SNP genotyping. Results In the amplification process of UPIP-qPCR, unlabeled intermediate primers with template-specific recognition functions could trigger probe hydrolysis and specific signal release. UPIP-qPCR can be used successfully and widely for SNP genotyping. The sensitivity of UPIP-qPCR in SNP genotyping was 0.01 ng, the call rate was more than 99.1%, and the accuracy was more than 99.9%. High-throughput DNA microarrays based on intermediate primers can be used for SNP genotyping. Conclusion This novel approach is both cost effective and highly accurate; it is a reliable SNP genotyping method that would serve the needs of the clinician in the provision of targeted medicine.

A Novel Serum tsRNA for Diagnosis and Prediction of Nephritis in SLE

ObjectiveDysregulation of transfer RNA (tRNA)-derived small noncoding RNA (tsRNA) signatures in human serum has been found in various diseases. Here, we determine whether the signatures of tsRNAs in serum can serve as biomarkers for diagnosis or prognosis of systemic lupus erythematosus (SLE).MethodsInitially, small RNA sequencing was employed for the screening serum tsRNAs obtained from SLE patients, followed by validation with TaqMan probe-based quantitative reverse transcription-PCR (RT-PCR) assay. Receiver operating characteristic (ROC) curve analysis was used to assess the diagnostic efficacy. The biological functions of tsRNAs were identified by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) assay.ResultsWe first analyzed tsRNA signatures in SLE serum and identified that tRF-His-GTG-1 was significantly upregulated in SLE serum. The combination of tRF-His-GTG-1 and anti-dsDNA could serve as biomarkers for diagnosing SLE with a high area under the curve (AUC) of 0.95 (95% CI = 0.92–0.99), sensitivity (83.72%), and specificity (94.19%). Importantly, the noninvasive serum tRF-His-GTG-1 could also be used to distinguish SLE with LN or SLE without LN with AUC of 0.81 (95% CI, 0.73–0.88) and performance (sensitivity 66.27%, specificity 96.15%). Moreover, the serum tsRNA is mainly secreted via exosome and can directly target signaling molecules that play crucial roles in regulating the immune system.ConclusionIn this study, it has been demonstrated for the first time that serum tsRNAs can be employed as noninvasive biomarkers for the efficient diagnosis and prediction of nephritis in SLE.

RAP: A Novel Approach to the Rapid and Highly Sensitive Detection of Respiratory Viruses

Recombinase aided amplification (RAA) is an emerging isothermal amplification method used for detecting various pathogens. However, RAA requires a complex and long probe to ensure high sensitivity during fluorescence assay. TaqMan probe used for quantitative PCR (qPCR) is simple and universal. Herein, we developed a new approach for detecting nucleic acids of pathogens, known as RAP (Recombinase aided PCR). The method combines RAA and qPCR to ensure a rapid and highly sensitive detection using a conventional qPCR device. RAP is a two-stage amplification process performed in a single tube within 1 hour. The method involves an RAA reaction for 10 min at 39°C (first stage) followed by 15 cycles of qPCR (second stage). Using human adenovirus 3 (HADV3) and human adenovirus 7 (HADV7) plasmids, the sensitivities of RAP assays for detecting HADV3 and HADV7 were 6 and 17 copies per reaction, respectively. The limit of RAP detection was at least 16-fold lower than the corresponding qPCR, and no-cross reaction with other respiratory viruses was observed. The results of RAP analysis revealed 100% consistency with qPCR assay. This study shows that RAP assay is a rapid, specific, and highly sensitive detection method with a potential for clinical and laboratory application.