scholarly journals Occurrence and detection of lesser known viruses and phytoplasmas in stone fruit orchards in Poland

2010 ◽  
Vol 22 (2) ◽  
pp. 51-57 ◽  
Author(s):  
Mirosława Cieślińska ◽  
Halina Morgaś
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Green Ring ◽  
Japanese Plum ◽  
Fruit Orchards ◽  
Leaf Virus ◽  
Cherry Trees

Abstract A survey was carried out on 38 commercial and experimental stone fruit orchards located in major growing areas of stone fruit trees in Poland to determine the incidence of lesser known viruses and phytoplasmas. Leaf samples from 145 sweet cherry and 102 sour cherry trees were tested for Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Cherry green ring mottle virus (CGRMV), Cherry mottle leaf virus (CMLV), and Cherry necrotic rusty mottle virus (CNRMV) using RT-PCR. Sixty samples collected from peach and 20 apricot trees were also tested for CGRMV. Eleven out of 145 sweet cherry and three out of 102 sour cherry trees were infected by LChV-1. CGRMV was detected in 10 sweet cherry, four sour cherry, 14 peach and two apricot trees. No LChV-2, CMLV and CNRMV were detected in any of the tested trees. Phloem tissue from samples of shoots collected from 145 sweet cherry, 102 sour cherry, 128 peach, 37 apricot, five nectarine and 20 European as well as Japanese plum trees were tested for phytoplasmas. The nested PCR of the extracted DNA with universal and specific primer pairs showed the presence of phytoplasmas in six sweet cherry, three sour cherry, nine peach, four apricot, one nectarine and three Japanese plum trees. The RFLP patterns of 16S rDNA fragments after digestion with RsaI, MseI, AluI, and SspI endonucleases indicated that selected stone fruit trees were infected by two distinct phytoplasmas belonging to the apple proliferation group. The stone fruit trees infected by LChV-1, CGRMV and phytoplasmas were grown in orchards localised in all seven regions

scholarly journals First Report of Cherry green ring mottle virus on Sweet Cherry in Poland

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1363-1363 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Nucleotide Sequence ◽  
Sweet Cherry ◽  
Pcr Amplification ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Green Ring ◽  
Bacterial Vector ◽  
Primer Sets ◽  
Cherry Trees

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, infects several Prunus species including sweet cherry, sour cherry, ornamental cherry, peach, and apricot throughout North America and Europe. On sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Sweet cherry trees are symptomless hosts of CGRMV. During the 2004 growing season, 27 sour and sweet cherry trees were tested for the presence of CGRMV. RNA was isolated from leaves using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and then evaluated by reverse transcription-polymerase chain reaction (RT-PCR) amplification. Two primer sets, GRMV7956/GRMV8316 (1) and NCP5/NCP3 (2), were used for amplification of the CGRMV coat protein gene (807 bp) or its fragment (366 bp), respectively. The cDNA fragments were cloned into bacterial vector pCR 2.1-TOPO, sequenced and analyzed using the Lasergene (DNASTAR, Madison, WI) computer program. Nucleotide sequence of the C328 isolate (GenBank Accession No. AY841279) was compared with corresponding regions of published sequences of CGRMV isolates. The nucleotide sequence of this isolate was 98% identical to the Leb isolate (GenBank Accession No. AF533157) from sour cherry. The lowest similarity (80%) was between the CP sequences of isolate C328 and an isolate from apricot (GenBank Accession No. AY172334.1). Results of biological indexing on Prunus serrulata ‘Shirofugen’ and ‘Kwanzan’ confirmed the infection of ‘Star’ sweet cherry with CGRMV. The indicators showed leaf epinasty and necrosis of fragments of midrib or veins characteristic for CGRMV (2). The CGRMV infection of the indicators was confirmed using RT-PCR. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals First Report of Cherry necrotic rusty mottle virus on Stone Fruit Trees in China

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 290-290 ◽  
Author(s):  
J. F. Zhou ◽  
G. P. Wang ◽  
L. N. Qu ◽  
C. L. Deng ◽  
Y. Wang ◽  
...  
Keyword(s):  
Sweet Cherry ◽  
Prunus Persica ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
Pcr Products

During the growing seasons of 2010 through 2012, leaf tissues from 206 stone fruit trees, including one flowering cherry, three sour cherry, six nectarine (Prunus persica L. var. nucipersica Schneider), 14 apricot, 24 plum (P. domestica L.), 41 sweet cherry, and 117 peach [P. persica (L.) Batsch] trees, grown in six provinces of China, were randomly collected and tested for the CNRMV infection by RT-PCR. Out of those sampled trees, 37 showed shot holes and vein yellowing symptoms. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al. (2). The primer pair CGRMV1/CGRMV2 (1) was used to amplify a fragment of 949 bp from CNRMV genome, which includes the CP gene (804 bp). PCR products with the expected size were detected in one sweet cherry, one apricot, one peach, one plum, and two sour cherry plants. However, no correlation between PCR data and symptom expression could be found. PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China, and sequences were deposited in the GenBank under accession nos. JX491635, JX491636, JX491637, JX648205, and JX648206. Results of sequence analysis showed that sequences of the five CNRMV isolates shared the highest nt (99.0 to 99.6%) and aa (98.9 to 100%) similarities with a cherry isolate from Germany (GenBank Accession No. AF237816). The sequence of one isolate from a peach tree (JX648205) was divergent and shared only 84.7 to 86.1% nt and 94.4 to 95.1% aa similarities with those cp sequences. Clones intra each isolate shared more than 99% nt similarities. To confirm CNRMV infection, seedlings of peach GF 305 were graft-inoculated with bud-woods from a peach and a sweet cherry tree, which was positive to CNRMV and also two other viruses: Cherry green ring mottle virus (CGRMV) and Plum bark necrosis stem pitting-associated virus (PBNSPaV), as tested by RT-PCR. Grafted seedlings were kept in an insectproof greenhouse and observed for symptom development. In May of the following year, some newly developed leaves of inoculated seedlings showed vein yellowing, ringspot, and shot hole symptoms. Results of Protein A sandwich (PAS)-ELISA using an antiserum raised against the recombinant CP of a CNRMV isolate (unpublished) and RT-PCR confirmed CNRMV infection in inoculated trees. In addition to CNRMV, tested seedlings were also found to be infected with CGRMV and PBNSPaV by RT-PCR. To our knowledge, this is the first report on the occurrence of CNRMV on stone fruit trees in China, and also the first record of the CNRMV infection in peach and plum plants. Given the economic importance of its hosts and the visible symptoms of the viral disease, it is important to prevent the virus spread by using virus-tested propagation materials. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

scholarly journals Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

2013 ◽  
Vol 19 (4) ◽  
pp. 326-330 ◽  
Author(s):  
In-Sook Cho ◽  
Gug-Seoun Choi ◽  
Seung-Kook Choi
Keyword(s):  
Sweet Cherry ◽  
Mottle Virus ◽  
Green Ring ◽  
Cherry Trees

scholarly journals Serological and molecular detection of Prune dwarf virus infecting stone fruits of Charmahal-va-Bakhtiari province, a central region of Iran

2013 ◽  
Vol 4 (1) ◽  
pp. 4
Author(s):  
Nourolah Soltani ◽  
Jamshid Hayati ◽  
Ghobad Babaei ◽  
Maryam Ebrahim Qomi
Keyword(s):  
Sweet Cherry ◽  
Fruit Trees ◽  
Coat Protein Sequence ◽  
Elisa Test ◽  
Stone Fruit ◽  
Stone Fruits ◽  
Rt Pcr ◽  
Leaf Chlorosis ◽  
Fruit Orchards ◽  
Das Elisa

<em>Prune dwarf</em> virus (PDV) is one of the major positive RNA viruses which cause economical damages in stone fruit trees. The symptoms of PDV vary between different stone fruits namely sour and sweet cherry, almond, peach, apricot and plum including leaf narrowing, leaf chlorosis, vein clearing, mosaic, leaf whitening, leathery leaf, bushy branches and stunt trees. During the years 2011 and 2012, 251 leaf samples were collected for detection of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province. DAS-ELISA test proved PDV presence serologically. Then, total RNA were extracted and tested by two-step RT-PCR which replicated partial and full coat protein sequence of PDV. One hundred and eighty one out of total samples (251 samples) showed PDV infection using serological and two-step RT-PCR assays, hence, incidence of PDV in Charmahal-va-Bakhtiari province was confirmed. This is the first report of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province and in Iran.

scholarly journals First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1073-1073 ◽  
Author(s):  
L. P. Wang ◽  
N. Hong ◽  
G. P. Wang ◽  
R. Michelutti ◽  
B. L. Zhang
Keyword(s):  
North America ◽  
Sweet Cherry ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Indicator Plants ◽  
First Report ◽  
Green Ring ◽  
Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

SEROLOGICAL PROPERTIES COMMON TO DIFFERENT ISOLATES OF SOME STONE-FRUIT VIRUSES

1961 ◽  
Vol 39 (6) ◽  
pp. 1387-1391 ◽  
Author(s):  
J. H. Tremaine ◽  
R. S. Willison
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Stone Fruit ◽  
Green Ring ◽  
Virus Antigens ◽  
Ring Spot ◽  
Gel Diffusion

Virus entities in cucumber associated with cherry yellows, green ring mottle, and necrotic ring spot of sour cherry; tatter leaf of sweet cherry; and prune dwarf were found to be serologically related but not identical. The virus antigens were compared in gel-diffusion precipitin tests with antisera prepared from both cucumber leaves and infected cherry petals.

scholarly journals First Report of Cherry necrotic rusty mottle virus Infecting Sweet Cherry Trees in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 164-164 ◽  
Author(s):  
I. S. Cho ◽  
G. S. Choi ◽  
S. K. Choi ◽  
E. Y. Seo ◽  
H. S. Lim
Keyword(s):  
Sweet Cherry ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Coat Protein Region ◽  
Pcr Products ◽  
Leafroll Virus ◽  
Leaf Virus ◽  
Cherry Trees

Cherry necrotic rusty mottle virus (CNRMV), an unassigned member in the family Betaflexiviridae, has been reported in sweet cherry in North America, Europe, New Zealand, Japan, China, and Chile. The virus causes brown, angular necrotic spots, shot holes on the leaves, gum blisters, and necrosis of the bark in several cultivars (1). During the 2012 growing season, 154 sweet cherry trees were tested for the presence of CNRMV by RT-PCR. Samples were randomly collected from 11 orchards located in Gyeonggi and Gyeongsang provinces in Korea. RNA was extracted from leaves using the NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands). The primer pair CGRMV1/2 (2) was used to amplify the coat protein region of CNRMV. Although none of the collected samples showed any notable symptoms, CNRMV PCR products of the expected size (949 bp) were obtained from three sweet cherry samples from one orchard in Gyeonggi province. The PCR products were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of the three Korean sequences obtained (GenBank Accession Nos. AB822635, AB822636, and AB822637) showed 97% nucleotide sequence identity with a flowering cherry isolate from Japan (EU188439), and shared 98.8 to 99.6% nucleotide and 99.6 to 100% amino acid similarities to each other. The CNRMV positive samples were also tested for Apple chlorotic leaf spot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry rasp leaf virus (CRLV), Cherry leafroll virus (CLRV), Cherry virus A (CVA), Little cherry virus 1 (LChV-1), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV) by RT-PCR. One of the three CNRMV-positive samples was also infected with CVA. To confirm CNRMV infection by wood indexing, Prunus serrulata cv. Kwanzan plants were graft-inoculated with chip buds from the CNRMV-positive sweet cherry trees. At 3 to 4 weeks post-inoculation, the Kwanzan plants showed quick decline with leaves wilting and dying; CNRMV infection of the indicators was confirmed by RT-PCR. To our knowledge, this is the first report of CNRMV infection of sweet cherry trees in Korea. Screening for CNRMV in propagation nurseries should minimize spread of this virus within Korea. References: (1) R. Li and R. Mock. Arch. Virol. 153:973, 2008. (2) R. Li and R. Mock. J. Virol. Methods 129:162, 2005.

scholarly journals Investigation of Virus Diseases and Molecular Detection of Little Cherry Virus 1 on Cherry Plants at Niğde Province

2019 ◽  
Vol 7 (7) ◽  
pp. 1008
Author(s):  
Quratul Ain Sajid ◽  
Eminur Elçi
Keyword(s):  
Leaf Roll ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Pcr Analysis ◽  
Spot Virus ◽  
Green Ring ◽  
Apple Stem ◽  
Cherry Leaf Roll Virus ◽  
Leaf Virus ◽  
Stem Pitting

To investigate the virus infections of sour and sweet cherries, various locations of Niğde province were examined during 2017. Ninety sweet and sour cherry leaf samples showing suspicious virus symptoms were collected and screened with virus-specific primers: Little cherry virus 1 (LChV1), Cherry necrotic rusty mottle virus (CNRMV), Prune dwarf virus (PDV), Prune necrotic ring spot virus (PNRSV), Apple mosaic virus (ApMV), Cherry green ring mottle virus (CGRMV), Cherry leaf roll virus (CLRV), Cherry mottle leaf virus (CMLV), Plum bark necrotic stem pitting associated virus (PBNSPaV), Cherry twisted leaf virus (CTLV), Apple stem grooving virus (ASGV), Little cherry virus 2 (LChV2), Cherry rusty leaf virus (CRLV), Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV). Based on RT-PCR analysis, no amplification was observed except LChV1 amplifications, dsRNA analysis resulted in one suspicious profile. To validate those results, more sensitive TaqMan Real-Time PCR analysis and sequence analysis were conducted and LChV1 was detected on 7 samples. It can be concluded that only a low quantity of LChV1 infections was observed on some of the screened cherry samples.

Sign in / Sign up

Export Citation Format

Share Document