Establishment of Tissue Culture System of Actinidia deliciosa Cultivar “Guichang”

In order to breed virus-free plantlets of the kiwifruit cultivar “Guichang,” which belongs to Actinidia deliciosa, in this study, stem segments with buds were used as explants, the establishment of a tissue culture rapid propagation system was carried out, and then the virus status of tissue culture plantlets was detected via the real-time reverse transcription-polymerase chain reaction (RT-qPCR) method. The tissue culture rapid propagation system proved that the contamination and browning rates could be controlled below 20% and the survival rate could be exceeded by 70% when the single bud stem segment of “Guichang” kiwifruit was sterilized with 70% alcohol for 30–60 s and 15% NaClO for 15 min, respectively. Meanwhile, we screened the hormone concentration to get better results, and the appropriate medium for adventitious bud induction was MS + 6-BA (1.0 mg/L) + IBA (0.2 mg/L); for proliferation, it was MS + 6-BA (1.0 mg/L) + IBA (0.1 mg/L); and for rooting, it was 1/2 MS + IBA (0.3 mg/L), and the efficiency of induction, proliferation, and rooting could reach 74.07%, 79.63%, and 85.18%, respectively. In addition, the RT-qPCR results demonstrated that the infection rate of 9 viruses: apple stem grooving virus (ASGV), cucumber mosaic virus (CMV), Actinidia virus X (AVX), cucumber necrosis virus (CNV), ribgrass mosaic virus (RMV), citrus leaf blotch virus (CLBV), Actinidia virus B (AcVB), Pelargonium zonate spot virus (PZSV), and cherry leaf roll virus (CLRV) in the “Guichang” kiwifruit tissue culture plantlets was 0. This study could lay a foundation for the production of “Guichang” kiwifruit tissue culture seedlings, and the medium formula provided in this study was useful for the industrial rapid propagation of “Guichang” plantlets.

Detection and phylogeny of viruses in native Albanian olive varieties

Forty samples representing 14 native Albanian and two foreign olive varieties were collected from an olive varietal collection plot in the Valias region (Tirana, Albania). The samples were assayed by RT-PCR for presence of olive-infecting viruses, including arabis mosaic virus (ArMV), cherry leaf roll virus (CLRV), cucumber mosaic virus (CMV), olive latent ringspot virus (OLRSV), olive latent virus 1 (OLV-1), olive leaf yellowing-associated virus (OLYaV), strawberry latent ringspot virus (SLRSV) and by PCR for the bacterium Xylella fastidiosa (Xf). Ninety-eight percent of the samples were infected with at least one virus. OLYaV was the most prevalent (85% of samples), followed by OLV-1 (50%), OLRSV (48%), CMV (28%), SLRSV (3%) and CLRV (5%), whereas ArMV and Xf were absent. Fifty-five percent of the samples were infected with one virus, 13% with two viruses, 20% with three, and 5% with four. Analyses of the nucleotide sequences of the Albanian virus isolates generally showed low genetic variability, and that most were phylogenetically related to Mediterranean isolates, in particular to those from Greece and Italy. Five olive trees, representing three native cultivars (‘Managiel’, ‘Kalinjot’ and ‘Kushan-Preze’) and one foreign (‘Leccino’), were found to be plants of the Conformitas Agraria Communitatis (“CAC”) category i.e. free of ArMV, CLRV, SLRSV and OLYaV. Only one tree of the native cultivar ‘Ulliri i kuq’ was free of all tested viruses, so this is plant material of the “Virus-tested” category. Olives derived from both categories could be used for propagation of standard quality plant materiel in a future certification programme for olive in Albania. This is the first report of CLRV, OLRSV, CMV and OLV-1 in Albania. The study also reveals the precarious health status of native olive varieties in the Valias varietal collection plot. However, the discovery of six plants representing two certifiable categories is a first step in a future olive tree certification program in the country.

Virus Surveys in Olive Orchards in Greece Identify Olive Virus T, a Novel Member of the Genus Tepovirus

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

Cherry leaf roll virus (walnut ringspot).

Seed transmission of CLRV is a threat to gene bank contamination. CLRV-contaminated vegetative propagation material and seeds are prone to extremely long-distance transport. Due to this risk potential, CLRV is included in the list of plant viruses that should be closely monitored during sanitary production of propagative material, especially for walnut and olive trees (Bassi and Martelli, 2003). CLRV is treated as an A2 quarantine pathogen in Rubus in the EPPO region, a virus-free certification scheme for Rubus was developed by OEPP/EPPO (1994). In cherry (Kegler et al., 1972; Bush, 2005), walnut (Mircetich et al., 1980; Delbos et al., 1983; Nemeth et al., 1990) and olive production areas, CLRV infections are consistently occurring (Langer et al., 2010; Büttner et al., 2011); crop losses due to CLRV infections were reported for cherry (Kegler et al., 1972; Bush, 2005), walnut (Mircetich et al., 1980; Delbos et al., 1983; Nemeth et al., 1990) and raspberry (Jones and Wood, 1978).In birch species native to Fennoscandia virus-like symptoms on leaves (vein banding, leaf roll, mottling), partially adherent with progressive loss of vitality or death of twigs and branches have been spreading rapidly since 2002 with up to 85% of the tested trees being infected with CLRV (Jalkanen et al., 2007; von Bargen et al., 2009a).

First report of Tobacco ringspot virus in highbush blueberry in Washington State

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Investigation of Virus Diseases and Molecular Detection of Little Cherry Virus 1 on Cherry Plants at Niğde Province

To investigate the virus infections of sour and sweet cherries, various locations of Niğde province were examined during 2017. Ninety sweet and sour cherry leaf samples showing suspicious virus symptoms were collected and screened with virus-specific primers: Little cherry virus 1 (LChV1), Cherry necrotic rusty mottle virus (CNRMV), Prune dwarf virus (PDV), Prune necrotic ring spot virus (PNRSV), Apple mosaic virus (ApMV), Cherry green ring mottle virus (CGRMV), Cherry leaf roll virus (CLRV), Cherry mottle leaf virus (CMLV), Plum bark necrotic stem pitting associated virus (PBNSPaV), Cherry twisted leaf virus (CTLV), Apple stem grooving virus (ASGV), Little cherry virus 2 (LChV2), Cherry rusty leaf virus (CRLV), Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV). Based on RT-PCR analysis, no amplification was observed except LChV1 amplifications, dsRNA analysis resulted in one suspicious profile. To validate those results, more sensitive TaqMan Real-Time PCR analysis and sequence analysis were conducted and LChV1 was detected on 7 samples. It can be concluded that only a low quantity of LChV1 infections was observed on some of the screened cherry samples.