scholarly journals First Report of Cherry green ring mottle virus on Sweet Cherry in Poland

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1363-1363 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Nucleotide Sequence ◽  
Sweet Cherry ◽  
Pcr Amplification ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Green Ring ◽  
Bacterial Vector ◽  
Primer Sets ◽  
Cherry Trees

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, infects several Prunus species including sweet cherry, sour cherry, ornamental cherry, peach, and apricot throughout North America and Europe. On sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Sweet cherry trees are symptomless hosts of CGRMV. During the 2004 growing season, 27 sour and sweet cherry trees were tested for the presence of CGRMV. RNA was isolated from leaves using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and then evaluated by reverse transcription-polymerase chain reaction (RT-PCR) amplification. Two primer sets, GRMV7956/GRMV8316 (1) and NCP5/NCP3 (2), were used for amplification of the CGRMV coat protein gene (807 bp) or its fragment (366 bp), respectively. The cDNA fragments were cloned into bacterial vector pCR 2.1-TOPO, sequenced and analyzed using the Lasergene (DNASTAR, Madison, WI) computer program. Nucleotide sequence of the C328 isolate (GenBank Accession No. AY841279) was compared with corresponding regions of published sequences of CGRMV isolates. The nucleotide sequence of this isolate was 98% identical to the Leb isolate (GenBank Accession No. AF533157) from sour cherry. The lowest similarity (80%) was between the CP sequences of isolate C328 and an isolate from apricot (GenBank Accession No. AY172334.1). Results of biological indexing on Prunus serrulata ‘Shirofugen’ and ‘Kwanzan’ confirmed the infection of ‘Star’ sweet cherry with CGRMV. The indicators showed leaf epinasty and necrosis of fragments of midrib or veins characteristic for CGRMV (2). The CGRMV infection of the indicators was confirmed using RT-PCR. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (10) ◽  
pp. 1073-1073 ◽  
Author(s):  
L. P. Wang ◽  
N. Hong ◽  
G. P. Wang ◽  
R. Michelutti ◽  
B. L. Zhang
Keyword(s):  
North America ◽  
Sweet Cherry ◽  
Sour Cherry ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Prunus Species ◽  
Indicator Plants ◽  
First Report ◽  
Green Ring ◽  
Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals Occurrence and detection of lesser known viruses and phytoplasmas in stone fruit orchards in Poland

2010 ◽  
Vol 22 (2) ◽  
pp. 51-57 ◽  
Author(s):  
Mirosława Cieślińska ◽  
Halina Morgaś
Keyword(s):  
Sweet Cherry ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Green Ring ◽  
Japanese Plum ◽  
Fruit Orchards ◽  
Leaf Virus ◽  
Cherry Trees

Abstract A survey was carried out on 38 commercial and experimental stone fruit orchards located in major growing areas of stone fruit trees in Poland to determine the incidence of lesser known viruses and phytoplasmas. Leaf samples from 145 sweet cherry and 102 sour cherry trees were tested for Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Cherry green ring mottle virus (CGRMV), Cherry mottle leaf virus (CMLV), and Cherry necrotic rusty mottle virus (CNRMV) using RT-PCR. Sixty samples collected from peach and 20 apricot trees were also tested for CGRMV. Eleven out of 145 sweet cherry and three out of 102 sour cherry trees were infected by LChV-1. CGRMV was detected in 10 sweet cherry, four sour cherry, 14 peach and two apricot trees. No LChV-2, CMLV and CNRMV were detected in any of the tested trees. Phloem tissue from samples of shoots collected from 145 sweet cherry, 102 sour cherry, 128 peach, 37 apricot, five nectarine and 20 European as well as Japanese plum trees were tested for phytoplasmas. The nested PCR of the extracted DNA with universal and specific primer pairs showed the presence of phytoplasmas in six sweet cherry, three sour cherry, nine peach, four apricot, one nectarine and three Japanese plum trees. The RFLP patterns of 16S rDNA fragments after digestion with RsaI, MseI, AluI, and SspI endonucleases indicated that selected stone fruit trees were infected by two distinct phytoplasmas belonging to the apple proliferation group. The stone fruit trees infected by LChV-1, CGRMV and phytoplasmas were grown in orchards localised in all seven regions

scholarly journals First Report of Cherry virus A in Sweet Cherry Trees in China

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 425-425 ◽  
Author(s):  
W.-L. Rao ◽  
Z.-K. Zhang ◽  
R. Li
Keyword(s):  
Sweet Cherry ◽  
Community Gardens ◽  
Mottle Virus ◽  
Replicase Gene ◽  
Rt Pcr ◽  
First Report ◽  
Type Isolate ◽  
The Family ◽  
Flowering Cherry ◽  
Cherry Trees

Plants in the genus Prunus of the family Rosaceae are important fruit and ornamental trees in China. In June of 2007, sweet cherry (Prunus avium) trees with mottling and mosaic symptoms were observed in a private garden near Kunming, Yunnan Province. Twenty-four samples, six each from sweet cherry, sour cherry (P. cerasus), flowering cherry (P. serrulata), and peach (P. persica) were collected from trees in private and community gardens in the area. The peach and sour and flowering cherry trees did not show any symptoms. Total nucleic acids were extracted using a cetyltrimethylammoniumbromide (CTAB) extraction method, and the extracts were tested for the following eight viruses by reverse transcription (RT)-PCR: American plum line pattern virus, Apple chlorotic leaf spot virus, Cherry green ring mottle virus, Cherry necrotic rusty mottle virus, Cherry virus A (CVA), Little cherry virus 1, Prune dwarf virus, and Prunus necrotic ringspot virus. Only CVA was detected in two symptomatic sweet cherry trees by RT-PCR with forward (5′-GTGGCATTCAACTAGCACCTAT-3′) and reverse (5′-TCAGCTGCCTCAGCTTGGC-3′) primers specific to an 873-bp fragment of the CVA replicase gene (2). The CVA infection of the two trees was confirmed by RT-PCR using primers CVA-7097U and CVA-7383L that amplified a 287-bp fragment from the 3′-untranslated region (UTR) of the virus (1). Amplicons from both amplifications were cloned and sequenced. Analysis of the predicted amino acid sequences of the 873-bp fragments (GenBank Accession Nos. EU862278 and EU862279) showed that they were 98% identical with each other and 97 to 98% with the type isolate of CVA from Germany (GenBank Accession No. NC_003689). The 286-bp sequences of the 3′-UTR (GenBank Accession Nos. FJ608982 and FJ608983) were 93% identical with each other and 93 to 98% with the type isolate. The sequence indicated that the three isolates were very similar and should be considered to be the same strain. CVA is a member of the genus Capillovirus in the family Flexiviridae and has been previously reported in Europe, North America, and Japan. The contribution of CVA to the symptoms observed and its distribution in China remain to be evaluated. To our knowledge, this is the first report of CVA in sweet cherry in China. References: (1) M. Isogai et al. J. Gen. Plant Pathol. 70:288. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995.

scholarly journals Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

2013 ◽  
Vol 19 (4) ◽  
pp. 326-330 ◽  
Author(s):  
In-Sook Cho ◽  
Gug-Seoun Choi ◽  
Seung-Kook Choi
Keyword(s):  
Sweet Cherry ◽  
Mottle Virus ◽  
Green Ring ◽  
Cherry Trees

scholarly journals First Report of Cherry virus A and Little cherry virus-1 in Poland

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Nucleotide Sequence ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Germplasm Collection ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Primer Sets

Cherry virus A (CVA), a member of the genus Capillovirus, has been reported in sweet cherry in Germany, Canada, and Great Britain. No data are available on the effects of CVA on fruit quality and yield of infected trees. Little cherry disease (LChD) occurs in most cherry growing areas of the world. Symptoms on sensitive cultivars include discolored fruit that remain small, pointed in shape, and tasteless. Three Closterovirus spp. associated with LChD have been described (Little cherry virus-1 [LChV-1], LChV-2, and LChV-3). Diseased local and commercial cultivars of sour cherry trees were found in a Prunus sp. germplasm collection and orchards in Poland during the 2003 growing season. The foliar symptoms included irregular, chlorotic mottling, distortion, and premature falling of leaves. Some of the diseased trees developed rosette as a result of decreased growth and shortened internodes. Severely infected branches exhibited dieback symptoms. Because the symptoms were suggestive of a possible virus infection, leaf samples were collected from 38 trees and assayed for Prune dwarf virus and Prunus necrotic ringspot virus using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). RNA extracted from leaves was used in a reverse transcription-polymerase chain reaction (RT-PCR) with the One-Step RT-PCR with Platinum Taq (Invitrogen Life Technologies) and primer sets specific for CVA (1), LChV-1 (3), and LChV-2 (3). The RNA samples were also tested using RT-PCR for detection of Cherry mottle leaf virus (CMLV), Cherry necrotic rusty mottle virus (CNRMV), and Cherry green ring mottle virus (CGRMV) with specific primer sets (2). Amplification of a 397-bp coat protein gene product confirmed infection of 15 trees with CVA. A 419-bp fragment corresponding to the coat protein gene of LChV-1 was amplified from cv. Gisela rootstock and local cv. WVIII/1. To confirm RT-PCR results, CVA amplification products from local cv. WX/5 and LChV-1 from cvs. Gisela and WVIII/1 were cloned in bacterial vector pCR 2.1-TOPO and then sequenced. The sequences were analyzed with the Lasergene (DNASTAR, Madison, WI) computer program. The alignment indicated that the nucleotide sequence of cv. WX/5 was closely related to the published sequences of CVA (Genbank Accession No. NC_003689) and had an 89% homology to the corresponding region. The nucleotide sequence similarity between the 419-bp fragment obtained from cvs. Gisela and WVIII/1 was 87% and 91%, respectively, compared with the reference isolate of LChV-1 (Genbank Accession No. NC_001836). The sampled trees tested negative for LChV-2, CGRMV, CMLV, and CNRMV using RT-PCR. Some trees tested positive for PNRSV and PDV. To our knowledge, this is the first report of CVA and LChV-1 in Poland. References: (1) D. James and W. Jelkmann. Acta Hortic. 472:299, 1998. (2) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411,2001. (3) M. E. Rott and W. Jelkmann. Phytopathology. 91:61, 2001.

scholarly journals Analysis of Double-Stranded RNAs from Cherry Trees with Stem Pitting in California

Plant Disease ◽  
1998 ◽  
Vol 82 (8) ◽  
pp. 871-874 ◽  
Author(s):  
Yun-Ping Zhang ◽  
J. K. Uyemoto ◽  
B. C. Kirkpatrick
Keyword(s):  
Sweet Cherry ◽  
Prunus Avium ◽  
Sour Cherry ◽  
Rt Pcr ◽  
Cloning And Sequencing ◽  
Green Ring ◽  
Flowering Cherry ◽  
Polymerase Chain ◽  
Stem Pitting ◽  
Dsrna Species

Five distinct dsRNA species were recovered from Bing sweet cherry (Prunus avium (L.) L.) trees with stem pitting symptoms. A 4.7-kilobase pair (kbp) dsRNA was isolated from mahaleb rootstock (P. mahaleb L.); an unrelated 4.7-kbp dsRNA, always co-purified with a 1.3-kbp dsRNA, and a 9-kbp dsRNA were from Bing cherry. In addition, an 8.5-kbp dsRNA found in diseased Shirofugen flowering cherry and in Bing cherry was identified as sour cherry green ring mottle virus (CGRMV). The larger, 8.5- and 9.0-kbp dsRNA species were graft-transmissible, while the smaller ones were non-transmissible and appeared cryptic in nature. Reverse transcription-polymerase chain reaction (RT-PCR) assays were developed for each dsRNA species by cloning and sequencing cDNA synthesized from the dsRNA templates. When several diseased collections were assayed by RT-PCR, approximately 14% reacted positively with primers for the 9.0-kbp dsRNA or CGRMV. Although CGRMV and the 9.0-kbp dsRNA caused wood-marking symptoms in graft-inoculated Mazzard (P. avium) seedling trees, no xylem or canopy symptoms developed in grafted Bing cherry. The causal agent or agents of cherry stem pitting have not been identified.

scholarly journals First Report of Cherry necrotic rusty mottle virus Infecting Sweet Cherry Trees in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 164-164 ◽  
Author(s):  
I. S. Cho ◽  
G. S. Choi ◽  
S. K. Choi ◽  
E. Y. Seo ◽  
H. S. Lim
Keyword(s):  
Sweet Cherry ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Coat Protein Region ◽  
Pcr Products ◽  
Leafroll Virus ◽  
Leaf Virus ◽  
Cherry Trees

Cherry necrotic rusty mottle virus (CNRMV), an unassigned member in the family Betaflexiviridae, has been reported in sweet cherry in North America, Europe, New Zealand, Japan, China, and Chile. The virus causes brown, angular necrotic spots, shot holes on the leaves, gum blisters, and necrosis of the bark in several cultivars (1). During the 2012 growing season, 154 sweet cherry trees were tested for the presence of CNRMV by RT-PCR. Samples were randomly collected from 11 orchards located in Gyeonggi and Gyeongsang provinces in Korea. RNA was extracted from leaves using the NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands). The primer pair CGRMV1/2 (2) was used to amplify the coat protein region of CNRMV. Although none of the collected samples showed any notable symptoms, CNRMV PCR products of the expected size (949 bp) were obtained from three sweet cherry samples from one orchard in Gyeonggi province. The PCR products were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of the three Korean sequences obtained (GenBank Accession Nos. AB822635, AB822636, and AB822637) showed 97% nucleotide sequence identity with a flowering cherry isolate from Japan (EU188439), and shared 98.8 to 99.6% nucleotide and 99.6 to 100% amino acid similarities to each other. The CNRMV positive samples were also tested for Apple chlorotic leaf spot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry rasp leaf virus (CRLV), Cherry leafroll virus (CLRV), Cherry virus A (CVA), Little cherry virus 1 (LChV-1), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV) by RT-PCR. One of the three CNRMV-positive samples was also infected with CVA. To confirm CNRMV infection by wood indexing, Prunus serrulata cv. Kwanzan plants were graft-inoculated with chip buds from the CNRMV-positive sweet cherry trees. At 3 to 4 weeks post-inoculation, the Kwanzan plants showed quick decline with leaves wilting and dying; CNRMV infection of the indicators was confirmed by RT-PCR. To our knowledge, this is the first report of CNRMV infection of sweet cherry trees in Korea. Screening for CNRMV in propagation nurseries should minimize spread of this virus within Korea. References: (1) R. Li and R. Mock. Arch. Virol. 153:973, 2008. (2) R. Li and R. Mock. J. Virol. Methods 129:162, 2005.

scholarly journals First Report of Cherry green ring mottle virus on Cherry and Peach Grown in China

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1319-1319 ◽  
Author(s):  
J. F. Zhou ◽  
G. P. Wang ◽  
R. F. Kuang ◽  
L. P. Wang ◽  
N. Hong
Keyword(s):  
Amino Acid ◽  
Sweet Cherry ◽  
Sandwich Elisa ◽  
Amino Acid Sequences ◽  
Central China ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Green Ring ◽  
Cp Gene ◽  
Pcr Products

Cherry green ring mottle virus (CGRMV; a member of the genus Foveavirus in the family Flexiviridae) has a single-stranded, positive-sense RNA genome of approximately 8.4 kb (4). The viral infection on several Prunus spp. has been mainly reported in Japan, New Zealand, and some countries in Africa, Europe, and North America (3). The virus can cause leaf yellowing on sour and tart cherry. Sweet cherry plants are symptomless hosts of the virus. During the growing season of 2010, leaf samples were collected randomly from one ornamental cherry (Prunus serrulata L.) and 26 sweet cherry (P. avium (L.) L.) plants grown in Shangdong and Henan provinces in northern China and 64 peach (P. persica L. Batsch) plants grown in Hubei Province in central China and tested for the presence of CGRMV by reverse transcription (RT)-PCR. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al (2). Primer set, CGRMV1/CGRMV2 (1), was used for the amplification of a 949-bp fragment, which contains the complete CP gene of 807 bp. PCR products with the expected size were identified in one ornamental cherry, seven sweet cherry, and eight peach plants. Although some of sampled plants showed leaf chlorosis, we did not find the specific association between the symptom and CGRMV infection. The obtained PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China. Results showed that CP sequences from the Chinese CGRMV isolates shared 87.7 to 99.8% nucleotide and 93.3 to 100% deduced amino acid similarities, and clones intra each isolate shared more than 99% nt similarities. The CP gene sequences of two representative isolates from cherry (YT-Ch-1) and peach (Pe-HB-18) were submitted to GenBank with Accession Nos. HQ539656 and JF810672, respectively. The neighbor-joining phylogenetic trees generated with nucleotide and amino acid sequences of CP genes by Clustal X v1.8 revealed that all Chinese CGRMV isolates fell into two well-resolved clades. Most of the Chinese CGRMV isolates (12 of 16 isolates, including the isolate YT-Ch-1) were grouped in a large clade represented by isolate ITA5 (GenBank Accession No. AF533159). Four isolates from peach (including the isolate Pe-HB-18) clustered into another clade represented by isolate ITA6 (GenBank Accession No. AF533160). In July 2010, peach GF305 seedlings were inoculated by side grafting with budwoods from two CGRMV positive cherry plants. In May 2011, some newly developed leaves from all inoculated plants showed vein yellowing. The CGRMV infection in these inoculated peach GF305 plants was detected by RT-PCR and protein A sandwich-ELISA using antiserum raised against the recombinant CP of CGRMV isolate YT-Ch-1 (unpublished data). These results further confirmed the CGRMV infection on field cherry plants as detected by RT-PCR. To our knowledge, this is the first record of the presence of CGRMV in ornamental and sweet cherry and peach plants in China, which provides valuable information for further evaluating the sanitary status of the virus in sweet cherry and peach orchards in China. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008. (3) K. G. Parker et al. USDA. Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

scholarly journals Cherry necrotic rusty mottle and Cherry green ring mottle viruses in Czech cherry germplasm

2017 ◽  
Vol 53 (No. 4) ◽  
pp. 195-200 ◽  
Author(s):  
Špak Josef ◽  
Přibylová Jaroslava ◽  
Šafářová Dana ◽  
Lenz Ondřej ◽  
Koloniuk Igor ◽  
...  
Keyword(s):  
Germplasm Collection ◽  
Sour Cherry ◽  
Mottle Virus ◽  
The Czech Republic ◽  
Green Ring ◽  
Negative Results ◽  
Polymerase Chain ◽  
Generation Sequencing ◽  
Complete Genomic ◽  
Cherry Trees

Using reverse transcription polymerase chain reaction, 160 sweet and sour cherry trees from a germplasm collection, orchards, and wild trees in the Czech Republic were screened for the presence of Cherry necrotic rusty mottle virus (CNRMV) and Cherry green ring mottle virus (CGRMV). The viruses were detected exclusively in sweet cherry trees in the germplasm collection, with CNRMV determined in two trees and CGRMV in four trees. Using next-generation sequencing, nearly complete genomic sequences (complete ORFs) were obtained for one CNRMV and three CGRMV isolates. Their relatedness to GenBank sequences of isolates from different countries together with negative results from screening outside of the germplasm collection suggests that the viruses had been imported with accessions.

scholarly journals First Report of Cherry necrotic rusty mottle virus on Stone Fruit Trees in China

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 290-290 ◽  
Author(s):  
J. F. Zhou ◽  
G. P. Wang ◽  
L. N. Qu ◽  
C. L. Deng ◽  
Y. Wang ◽  
...  
Keyword(s):  
Sweet Cherry ◽  
Prunus Persica ◽  
Sour Cherry ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
Pcr Products

During the growing seasons of 2010 through 2012, leaf tissues from 206 stone fruit trees, including one flowering cherry, three sour cherry, six nectarine (Prunus persica L. var. nucipersica Schneider), 14 apricot, 24 plum (P. domestica L.), 41 sweet cherry, and 117 peach [P. persica (L.) Batsch] trees, grown in six provinces of China, were randomly collected and tested for the CNRMV infection by RT-PCR. Out of those sampled trees, 37 showed shot holes and vein yellowing symptoms. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al. (2). The primer pair CGRMV1/CGRMV2 (1) was used to amplify a fragment of 949 bp from CNRMV genome, which includes the CP gene (804 bp). PCR products with the expected size were detected in one sweet cherry, one apricot, one peach, one plum, and two sour cherry plants. However, no correlation between PCR data and symptom expression could be found. PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China, and sequences were deposited in the GenBank under accession nos. JX491635, JX491636, JX491637, JX648205, and JX648206. Results of sequence analysis showed that sequences of the five CNRMV isolates shared the highest nt (99.0 to 99.6%) and aa (98.9 to 100%) similarities with a cherry isolate from Germany (GenBank Accession No. AF237816). The sequence of one isolate from a peach tree (JX648205) was divergent and shared only 84.7 to 86.1% nt and 94.4 to 95.1% aa similarities with those cp sequences. Clones intra each isolate shared more than 99% nt similarities. To confirm CNRMV infection, seedlings of peach GF 305 were graft-inoculated with bud-woods from a peach and a sweet cherry tree, which was positive to CNRMV and also two other viruses: Cherry green ring mottle virus (CGRMV) and Plum bark necrosis stem pitting-associated virus (PBNSPaV), as tested by RT-PCR. Grafted seedlings were kept in an insectproof greenhouse and observed for symptom development. In May of the following year, some newly developed leaves of inoculated seedlings showed vein yellowing, ringspot, and shot hole symptoms. Results of Protein A sandwich (PAS)-ELISA using an antiserum raised against the recombinant CP of a CNRMV isolate (unpublished) and RT-PCR confirmed CNRMV infection in inoculated trees. In addition to CNRMV, tested seedlings were also found to be infected with CGRMV and PBNSPaV by RT-PCR. To our knowledge, this is the first report on the occurrence of CNRMV on stone fruit trees in China, and also the first record of the CNRMV infection in peach and plum plants. Given the economic importance of its hosts and the visible symptoms of the viral disease, it is important to prevent the virus spread by using virus-tested propagation materials. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

Sign in / Sign up

Export Citation Format

Share Document