First Report of Cherry necrotic rusty mottle virus Infecting Sweet Cherry Trees in Korea

Cherry necrotic rusty mottle virus (CNRMV), an unassigned member in the family Betaflexiviridae, has been reported in sweet cherry in North America, Europe, New Zealand, Japan, China, and Chile. The virus causes brown, angular necrotic spots, shot holes on the leaves, gum blisters, and necrosis of the bark in several cultivars (1). During the 2012 growing season, 154 sweet cherry trees were tested for the presence of CNRMV by RT-PCR. Samples were randomly collected from 11 orchards located in Gyeonggi and Gyeongsang provinces in Korea. RNA was extracted from leaves using the NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands). The primer pair CGRMV1/2 (2) was used to amplify the coat protein region of CNRMV. Although none of the collected samples showed any notable symptoms, CNRMV PCR products of the expected size (949 bp) were obtained from three sweet cherry samples from one orchard in Gyeonggi province. The PCR products were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of the three Korean sequences obtained (GenBank Accession Nos. AB822635, AB822636, and AB822637) showed 97% nucleotide sequence identity with a flowering cherry isolate from Japan (EU188439), and shared 98.8 to 99.6% nucleotide and 99.6 to 100% amino acid similarities to each other. The CNRMV positive samples were also tested for Apple chlorotic leaf spot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry rasp leaf virus (CRLV), Cherry leafroll virus (CLRV), Cherry virus A (CVA), Little cherry virus 1 (LChV-1), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV) by RT-PCR. One of the three CNRMV-positive samples was also infected with CVA. To confirm CNRMV infection by wood indexing, Prunus serrulata cv. Kwanzan plants were graft-inoculated with chip buds from the CNRMV-positive sweet cherry trees. At 3 to 4 weeks post-inoculation, the Kwanzan plants showed quick decline with leaves wilting and dying; CNRMV infection of the indicators was confirmed by RT-PCR. To our knowledge, this is the first report of CNRMV infection of sweet cherry trees in Korea. Screening for CNRMV in propagation nurseries should minimize spread of this virus within Korea. References: (1) R. Li and R. Mock. Arch. Virol. 153:973, 2008. (2) R. Li and R. Mock. J. Virol. Methods 129:162, 2005.

Download Full-text

First Report of Cherry virus A in Sweet Cherry Trees in China

Plant Disease ◽

10.1094/pdis-93-4-0425b ◽

2009 ◽

Vol 93 (4) ◽

pp. 425-425 ◽

Cited By ~ 4

Author(s):

W.-L. Rao ◽

Z.-K. Zhang ◽

R. Li

Keyword(s):

Sweet Cherry ◽

Community Gardens ◽

Mottle Virus ◽

Replicase Gene ◽

Rt Pcr ◽

First Report ◽

Type Isolate ◽

The Family ◽

Flowering Cherry ◽

Cherry Trees

Plants in the genus Prunus of the family Rosaceae are important fruit and ornamental trees in China. In June of 2007, sweet cherry (Prunus avium) trees with mottling and mosaic symptoms were observed in a private garden near Kunming, Yunnan Province. Twenty-four samples, six each from sweet cherry, sour cherry (P. cerasus), flowering cherry (P. serrulata), and peach (P. persica) were collected from trees in private and community gardens in the area. The peach and sour and flowering cherry trees did not show any symptoms. Total nucleic acids were extracted using a cetyltrimethylammoniumbromide (CTAB) extraction method, and the extracts were tested for the following eight viruses by reverse transcription (RT)-PCR: American plum line pattern virus, Apple chlorotic leaf spot virus, Cherry green ring mottle virus, Cherry necrotic rusty mottle virus, Cherry virus A (CVA), Little cherry virus 1, Prune dwarf virus, and Prunus necrotic ringspot virus. Only CVA was detected in two symptomatic sweet cherry trees by RT-PCR with forward (5′-GTGGCATTCAACTAGCACCTAT-3′) and reverse (5′-TCAGCTGCCTCAGCTTGGC-3′) primers specific to an 873-bp fragment of the CVA replicase gene (2). The CVA infection of the two trees was confirmed by RT-PCR using primers CVA-7097U and CVA-7383L that amplified a 287-bp fragment from the 3′-untranslated region (UTR) of the virus (1). Amplicons from both amplifications were cloned and sequenced. Analysis of the predicted amino acid sequences of the 873-bp fragments (GenBank Accession Nos. EU862278 and EU862279) showed that they were 98% identical with each other and 97 to 98% with the type isolate of CVA from Germany (GenBank Accession No. NC_003689). The 286-bp sequences of the 3′-UTR (GenBank Accession Nos. FJ608982 and FJ608983) were 93% identical with each other and 93 to 98% with the type isolate. The sequence indicated that the three isolates were very similar and should be considered to be the same strain. CVA is a member of the genus Capillovirus in the family Flexiviridae and has been previously reported in Europe, North America, and Japan. The contribution of CVA to the symptoms observed and its distribution in China remain to be evaluated. To our knowledge, this is the first report of CVA in sweet cherry in China. References: (1) M. Isogai et al. J. Gen. Plant Pathol. 70:288. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995.

Download Full-text

First Report of Cherry necrotic rusty mottle virus on Stone Fruit Trees in China

Plant Disease ◽

10.1094/pdis-09-12-0836-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 290-290 ◽

Cited By ~ 6

Author(s):

J. F. Zhou ◽

G. P. Wang ◽

L. N. Qu ◽

C. L. Deng ◽

Y. Wang ◽

...

Keyword(s):

Sweet Cherry ◽

Prunus Persica ◽

Sour Cherry ◽

Fruit Trees ◽

Stone Fruit ◽

Mottle Virus ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

Pcr Products

During the growing seasons of 2010 through 2012, leaf tissues from 206 stone fruit trees, including one flowering cherry, three sour cherry, six nectarine (Prunus persica L. var. nucipersica Schneider), 14 apricot, 24 plum (P. domestica L.), 41 sweet cherry, and 117 peach [P. persica (L.) Batsch] trees, grown in six provinces of China, were randomly collected and tested for the CNRMV infection by RT-PCR. Out of those sampled trees, 37 showed shot holes and vein yellowing symptoms. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al. (2). The primer pair CGRMV1/CGRMV2 (1) was used to amplify a fragment of 949 bp from CNRMV genome, which includes the CP gene (804 bp). PCR products with the expected size were detected in one sweet cherry, one apricot, one peach, one plum, and two sour cherry plants. However, no correlation between PCR data and symptom expression could be found. PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China, and sequences were deposited in the GenBank under accession nos. JX491635, JX491636, JX491637, JX648205, and JX648206. Results of sequence analysis showed that sequences of the five CNRMV isolates shared the highest nt (99.0 to 99.6%) and aa (98.9 to 100%) similarities with a cherry isolate from Germany (GenBank Accession No. AF237816). The sequence of one isolate from a peach tree (JX648205) was divergent and shared only 84.7 to 86.1% nt and 94.4 to 95.1% aa similarities with those cp sequences. Clones intra each isolate shared more than 99% nt similarities. To confirm CNRMV infection, seedlings of peach GF 305 were graft-inoculated with bud-woods from a peach and a sweet cherry tree, which was positive to CNRMV and also two other viruses: Cherry green ring mottle virus (CGRMV) and Plum bark necrosis stem pitting-associated virus (PBNSPaV), as tested by RT-PCR. Grafted seedlings were kept in an insectproof greenhouse and observed for symptom development. In May of the following year, some newly developed leaves of inoculated seedlings showed vein yellowing, ringspot, and shot hole symptoms. Results of Protein A sandwich (PAS)-ELISA using an antiserum raised against the recombinant CP of a CNRMV isolate (unpublished) and RT-PCR confirmed CNRMV infection in inoculated trees. In addition to CNRMV, tested seedlings were also found to be infected with CGRMV and PBNSPaV by RT-PCR. To our knowledge, this is the first report on the occurrence of CNRMV on stone fruit trees in China, and also the first record of the CNRMV infection in peach and plum plants. Given the economic importance of its hosts and the visible symptoms of the viral disease, it is important to prevent the virus spread by using virus-tested propagation materials. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

Download Full-text

First Report of Cherry mottle leaf virus Infecting Cherry in China

Plant Disease ◽

10.1094/pdis-01-14-0058-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1161-1161 ◽

Cited By ~ 1

Author(s):

Y. X. Ma ◽

J. J. Li ◽

G. F. Li ◽

S. F. Zhu

Keyword(s):

Capsid Protein ◽

Sweet Cherry ◽

Restriction Site ◽

Protein Gene ◽

Capsid Protein Gene ◽

First Report ◽

Pcr Product ◽

Sweet Cherry Cultivars ◽

Leaf Virus ◽

Cherry Trees

Cherry mottle leaf virus (CMLV) is a member of the genus Trichovirus (family Betaflexiviridae). CMLV infects several species of the genus Prunus including cherry (Prunus avium) and peach (P. persica) (2,3). It is spread via budding and grafting with infected wood and can be transmitted from infected bitter cherry (P. emarginata), or infected but symptomless peach trees to healthy sweet cherry trees by the bud mite (Eriophyes inaequalis) (1). On susceptible sweet cherry cultivars, CMLV causes symptoms such as chlorotic mottle-leaf pattern, distortion, puckering of younger leaves, and small fruits that ripen late (1), which may lead to severe economic losses in some cultivars. Cherry is one of the most important fruit tree species in North China, and Shandong Province is one of the major cherry production areas. In June 2013, a survey of possible CMLV presence was conducted in a cherry orchard planted in 1996 in Zoucheng city, Shandong. The sweet cherry cultivars in this orchard included Black Tartarian, Bing, Hongdeng (a hybrid between cvs. Napoleon and Huangyu), and others; the rootstock cultivar utilized to graft these cultivars was mountain cherry (P. tomentosa). During the survey, characteristic symptoms on leaves such as leaf mottling, distortion, and puckering similar to those caused by CMLV were observed on some trees of the cv. Hongdeng, and the symptomatic trees accounted for ~10% of the total trees of this cultivar. Five symptomatic cherry leaf samples and three healthy-looking cherry leaf samples of cv. Hongdeng were collected. Total RNA extracted from the leaf samples using RNeasy plant mini kit (Qiagen Inc., Valencia, CA) was subjected to first strand cDNA synthesis with the reverse primer CMLV-3R (5′-CTCGAGAACACAGAGATTTGTCGAGAC-3′, sequence in italics indicates restriction site XhoI) and M-MLV reverse transcriptase (Promega, Madison, WI) according to the manufacturer's instruction. The cDNA was then used as template in the PCR assay using primers CMLV-5F (5′-GGATCCATGTCGGCGCGATTGAATC-3′, sequence in italics indicates restriction site BamHI) and CMLV-3R, which amplify the genome fragment including the capsid protein gene of CMLV. The expected PCR product ~590 bp was amplified from all five symptomatic samples, while no such PCR product was amplified from the symptomless samples. The PCR products were cloned into pMD18-T vector (TaKaRa, Dalian, China). Three positive clones for each of the five amplicons were sequenced in both directions. Sequence alignment and nucleotide BLAST analysis of the sequences revealed that they were 99% to 100% identical to the corresponding capsid protein gene sequence of a cherry isolate of CMLV (GenBank Accession No. AF170028) and 85% identical with that of the peach wart strain of CMLV (KC207480). Our results confirm the infection of cherry trees by CMLV in Shandong. To our knowledge, this is the first report of CMLV on cherry in China. As the spread of CMLV by mite vector in the field is rare (1), and no bud mite outbreak had occurred in this orchard in the past years, so it is possible that virus-infected propagation materials are largely responsible for the spread of this virus. Considering the importance of cherry cultivation in China, this report prompts the need to survey the occurrence of this virus in Shandong and other provinces, and the need to develop more effective management strategies such as the use of certified virus-free nursery stocks to reduce the impact of CMLV. References: (1) J. E. Adaskaveg et al. Diseases. Page 61 in: UC IPM Pest Management Guidelines: Cherry. University of California ANR Publication 3444, 2014. (2) D. James et al. Arch. Virol. 145:995, 2000. (3) T. A. Mekuria et al. Arch. Virol. 158:2201, 2013.

Download Full-text

First Report of Little cherry virus 2 in Flowering and Sweet Cherry Trees in China

Plant Disease ◽

10.1094/pdis-10-10-0766 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1484-1484 ◽

Cited By ~ 4

Author(s):

W.-L. Rao ◽

F. Li ◽

R.-J. Zuo ◽

R. Li

Keyword(s):

Sweet Cherry ◽

Sequence Data ◽

Community Gardens ◽

Economic Losses ◽

Helicase Domain ◽

Rt Pcr ◽

Viral Origin ◽

First Report ◽

Flowering Cherry ◽

Cherry Trees

Many viruses infect Prunus spp. and cause diseases on them. During a survey of stone fruit trees in 2008 and 2009, flowering cherry (Prunus serrulata) and sweet cherry (P. avium) trees with foliar chlorosis and reddening, stem deformity, and tree stunting were observed in private orchards in Anning and Fumin counties of Yunnan Province. Some sweet cherry trees with severe symptoms yielded small and few fruits and had to be removed. Leaf samples were collected from 68 flowering cherry and 30 sweet cherry trees, either symptomatic or asymptomatic, from private orchards and community gardens in Kunming and counties Anning, Chenggong, Fumin, Jinning, Ludian and Yiliang. Total nucleic acids were extracted with a CTAB extraction method and tested by reverse transcription (RT)-PCR assay using virus-specific primers. Little cherry virus 2 (LChV-2), Cherry virus A (CVA), Prunus necrotic ringspot virus (PNRSV), and Prune dwarf virus (PDV) were detected and infection rates were 68.4, 16.3, 9.2, and 7.1%, respectively. Infection of LChV-2 was common in all counties except Ludian where the orchards were healthy. Of 68 infected trees, 29 were found to be infected with LChV-2 and CVA, PDV or PNRSV. LChV-2 was detected in this study by RT-PCR using a pair of novel primers, LCV2-1 (5′-TTCAATATGAGCAGTGTTCCTAAC-3′) and LCV2-4 (5′-ACTCGTCTTGTGACATACCAGTC-3′), in 59 flowering cherry (87%) and 8 sweet cherry (27%) trees, respectively. The primer pair was designed according to alignment of three available LChV-2 sequences (GenBank Nos. NC_005065, AF416335, and AF333237) to amplify the partial RNA-dependent RNA polymerase gene (ORF1b) of 781 bp. The amplicons of selected samples (Anning26 and Yiliang60) were sequenced directly and sequences of 651 bp (GenBank No. HQ412772) were obtained from both samples. Pairwise comparisons and phylogenetic analysis of the sequences show that the two isolates are identical to one another and share 92 to 96% at the amino acid (aa) sequence level to those of other isolates available in the GenBank database. The sequence data confirm that these isolates are a strain of LChV-2 and genetic variation among different strains is relatively high (2). Biological and serological assays are not available for the LChV-2 detection; therefore, the LChV-2 infections of these trees were further confirmed by RT-PCR using primer pair LCV2-5 (5′-TGTTTGTGTCATGTTGTCGGAGAAG-3′) and LCV2-6 (5′-TGAATACCCGAGAACAAGGACTC-3′), which amplified the helicase domain (ORF1a) of ~451 bp. The amplicons from samples Anning26 and Yiliang60 were cloned and sequenced. The 408-bp sequences (excluding primer sequences) were 92 to 98% identical at the aa sequence level to those of other isolates, confirming again their viral origin. LChV-2 (genus Ampelovirus, family Closteroviridae) (4) has been associated with little cherry disease (LChD), a widespread viral disease of sweet and sour cherries (1,3). The virus is transferred between geographic areas mainly by propagated materials. Ornamental and sweet cherries are important crops in China and LChD has the potential to cause significant economic losses. Thus, certified clean stock should be used to establish new orchards. To our knowledge, this is the first report of LChV-2 in cherries in China. References: (1) N. B. Bajet et al. Plant Dis. 92:234, 2008. (2) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (3) B. Komorowska and M. Cieslińska, Plant Dis. 92:1366, 2008. (4) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005.

Download Full-text

First Report of Little cherry virus 1 Infecting Sweet Cherry in Ontario, Canada

Plant Disease ◽

10.1094/pdis-04-21-0798-pdn ◽

2021 ◽

Author(s):

Aaron Simkovich ◽

Susanne Kohalmi ◽

Aiming Wang

Keyword(s):

San Diego ◽

Sweet Cherry ◽

The United States ◽

Eastern Region ◽

Rt Pcr ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Blastn Search ◽

Cherry Trees

The Niagara fruit belt is one of the richest fruit-producing areas in Canada, contributing to 90% of Ontario's tender fruits such as peach, plum and sweet cherry. Little cherry virus 1 (LCV1) of the genus Velarivirus is a causal agent of little cherry disease which has devastated cherry crops in many regions (Eastwell and Bernardy 1998, Jelkmann and Eastwell, 2011). From 2013 to 2018, foliar symptoms indicative of viral infection such as leaf deformation, ringspot, mottling, vein clearing, and reddening were found on sweet cherry trees grown in the Niagara region. To determine if these trees were infected by a virus, small RNAs (sRNAs) were isolated from separately pooled asymptomatic and symptomatic leaves using the mirPremier microRNA isolation kit (Sigma Aldrich Canada, Oakville, ON). The sRNAs were used to create two libraries (four leaves per library) with the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA). The sRNA libraries were separately sequenced with the MiSeq Desktop Sequencer (Illumina, San Diego, CA). In total, 5,380,196 reads were obtained and Trimmomatic (Bolger et al. 2014) was used to remove adaptors. The remaining 4,733,804 clean reads were assembled into contigs using Velvet 0.7.31 (Zerbino and Birney, 2008) and Oases 0.2.09 (Schulz et al. 2012) with minimum length of 75 nt (Supplementary Table 1). A BLASTn search (Altschul et al. 1997) of the contigs identified the presence of Cherry virus A (genus: Capillovirus), two members of the Ilarvirus genus (Prunus necrotic ringspot virus and Prune dwarf virus) in both libraries. LCV1 was only found in contigs derived from the symptomatic library. Of the clean reads, 22,016 were assembled into six contigs (with lengths ranging from 86 to 116 nt, Supplementary Table 1) mapping to LCV1, covering 7.07% of the viral genome. To confirm LCV1 infection, primers were designed from the assembled contigs and used for reverse transcription polymerase chain reaction (RT-PCR). Amplicons were sequenced and the terminal sequences were determined using 5’ and 3’ RACE Systems (Invitrogen, Burlington, ON). Degenerate primers were designed from multiple sequence alignments of published LCV1 genomes for amplification and primer walking to obtain the sequence of LCV1 (Table S2). The complete genome sequence of LCV1 has a length of 16,934 nt and was deposited in GenBank (accession no. MN508820). A BLASTn search showed that this isolate is nearly identical (99.6% sequence identity) to an isolate from California (accession no. MN131067). To determine the incidence of infection, a field survey was performed at the same location during spring months of 2014 to 2018 using RT-PCR with primers specific to the viral coat protein gene (Supplementary Tale 2). Among 46 cherry trees sampled, two (4.3%) trees were infected with LCV1 and showed negative results with CVA, PNRSV and PDV. Both trees displayed mild suturing of primary and secondary veins (Supplementary Figure 1). LCV1 has been identified in Western stone fruit producing regions (British Columbia in Canada, and Washington, California, and Oregon in the United States of America). To the best of our knowledge, this is the first report of LCV1 in any eastern region of Canada. The low incidence of LCV1 suggests that this virus is not widespread in this region. Routine monitoring and detection of LCV1 is required to prevent this devastating cherry disease from spreading in this region.

Download Full-text

First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽

10.1094/pdis-04-14-0356-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1285-1285 ◽

Cited By ~ 5

Author(s):

S. Lim ◽

Y.-H. Lee ◽

D. Igori ◽

F. Zhao ◽

R. H. Yoo ◽

...

Keyword(s):

Nucleotide Sequence ◽

South Korea ◽

Mosaic Virus ◽

Soybean Mosaic Virus ◽

Nucleotide Sequences ◽

Mottle Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

Download Full-text

First Report of Apple chlorotic leaf spot virus, Cherry green ring mottle virus, and Cherry necrotic rusty mottle virus on Peach in Montenegro

Plant Disease ◽

10.1094/pdis-10-13-1085-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1014-1014 ◽

Cited By ~ 2

Author(s):

J. Zindović ◽

M. Dall'Ara ◽

C. Rubies Autonell ◽

C. Ratti

Keyword(s):

Sequence Analysis ◽

Leaf Spot ◽

Mottle Virus ◽

Virus Infectivity ◽

Post Inoculation ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Green Ring ◽

Chlorotic Leaf

The sanitary status of peach fruit trees was assessed in central and coastal regions of Montenegro during a survey in September and October of 2011 and 2012. Leaf samples were collected from 58 (2011) and 47 (2012) trees showing chlorotic rings and spots, mosaic, necrosis, leaf distortion, and stunting. Total RNAs was extracted from each sample by RNeasy Plant Mini kit (Qiagen, Germany) and used as a template in PDO (polyvalent degenerate oligonucleotides) nested reverse transcription (RT)-PCR for the detection of fruit tree viruses belonging to the genera Trichovirus, Capillovirus, and Foveavirus (family Betaflexiviridae). PDO primer sets PDO-F1i/PDO-R3i/PDO-R4i and PDO-F2i/PDO-R1i (2) were used in the first RT-PCR and nested PCR, respectively. Total RNAs obtained from Italian Apple chlorotic leaf spot virus (ACLSV)-infected isolate and healthy peach leaves were used as positive and negative controls, respectively. A nested set of primers amplified a 362-bp product from 6 samples collected in 2011 (10.3%) and 13 samples collected in 2012 (27.7%). Sequence analysis included three isolates (367/11, 133/12, and 168/12) chosen from different peach cultivars (Ritastar, Spring Belle, and Redhaven, respectively). Amplified products of expected size of the partial RNA-dependent RNA polymerase from three positive samples were cloned into p-GEM-T Easy Vector (Promega, Madison, WI) and sequenced (MWG-Biotech AG, Germany). Sequences were deposited in GenBank under accession nos. KF534757, KF534769, and KF534766, respectively. BLAST analysis showed that the sequence of isolate 367/11 (KF534757) shared high nucleotide similarity (78.9 to 87.2%) with ACLSV isolates from GenBank, showing highest identity with isolate PBM1 (AJ243438) from Germany. Sequence analysis of isolate 133/12 (KF534769) proved that it is 90.5 to 93.3% identical to Cherry green ring mottle virus (CGRMV) isolates reported from other parts of the world. In particular, the highest nucleotide similarity was showed with isolate P1C124 (AJ291761) from France. Finally, analysis of sequence from the isolate 168/12 (KF534766) revealed high degree of identity (86.1 to 96.1%) with the corresponding nucleotide sequences of the Cherry necrotic rusty mottle virus (CNRMV) isolates, showing highest similarity with isolate 120/86 (AF237816) from Switzerland. To confirm virus infectivity, according to the FAO/IPGRI Technical Guidelines (1), budwood from 367/11, 133/12, and 168/12 samples were grafted into seedlings of peach (GF305), Prunus serrulata (cv. Shirofugen) and P. avium (cv. Sam) then maintained in a greenhouse with controlled conditions. Six months post inoculation, GF305 indexed with 367/11 sample reacts with a green depressed mottle on leaves typical of ACLSV infection. Cherry tree of cv. Shirofugen indexed with sample 133/12 showed symptoms attributable to CGRMV such as epinasty, twisting and curling of leaves while a tree of cv. Sam indexed with 168/12 sample exhibited classical necrotic shot holes in leaves induced by CNRMV infection (1). Sequence analysis of PCR products obtained from indicator plants by RT-PCR as described above showed full nucleotide identity with KF534757, KF534769, and KF534766 sequences and confirmed the presence of previous described viral agents. To our knowledge, this is the first report of ACLSV, CGRMV, and CNRMV occurrence on peach in Montenegro. Due to the economic importance of this crop, sanitation measures should be adopted to improve the control of imported plants and the use of virus-tested propagation material in order to prevent spreading of these viruses. References: (1) M. Diekmann and C. A. J. Putter. FAO/IPGRI Technical Guidelines for the Safe Movement of Germplasm. No. 16. Stone Fruits, 1996. (2) X. Foissac et al. Phytopathology 95:617, 2005.

Download Full-text

First Report of Little cherry virus 2 from Sweet Cherry in Poland

Plant Disease ◽

10.1094/pdis-92-9-1366a ◽

2008 ◽

Vol 92 (9) ◽

pp. 1366-1366 ◽

Cited By ~ 3

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Coat Protein ◽

Sweet Cherry ◽

Prunus Avium ◽

Late Summer ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

Nontranslated Region ◽

Methyltransferase Gene ◽

Cherry Trees

Little cherry disease (LChD) is a serious viral disease of sweet (Prunus avium) and sour (P. cerasus) cherry trees. Infection of sensitive cultivars results in small, angular, and pointed fruits with reduced sweetness. In late summer, leaves show a characteristic red coloration or bronzing of the surfaces. One Ampelovirus species, Little cherry virus 2 (LChV-2) (2), and one unassigned species in the Closteroviridae, Little cherry virus 1 (LChV-1) (3), have been associated with LChD. Twenty-seven sour and sweet cherry trees of six varieties from orchards located in several regions of Poland were tested for LChV-1 and LChV-2. Leaf samples were taken either from trees showing fruit symptoms or from asymptomatic trees during the summer of the 2006 growing season. RNA was isolated from the leaves with an RNeasy Kit (Qiagen, Hilden, CA), and reverse transcription (RT)-PCR was performed using primer pairs LCV1U/LCV1L and LCV2UP2/LCV2LO2, which are specific for a 419-bp fragment of the LChV-1 3′ nontranslated region and a 438-bp fragment of the LChV-2 methyltransferase gene, respectively (1). The primer pair L2CPF (5′-GTTCGAAAGTGTTTCTTGAT-3′) and L2CPR (5′-GCAACAGAAAAACATATGACTCA-3′) was designed from existing LChV-2 sequences (GenBank Accession Nos. AF416335 and NC_005065) to amplify the entire LChV-2 coat protein (CP) gene (nucleotides 13,007 to 14,134). The amplified cDNA fragments of LChV-2 genome were ligated to the bacterial vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA), which was used to transform Escherichia coli TOP10 competent cells following the manufacturer's protocol. Both strands of three clones for each amplified LChV-2 genome fragment were sequenced with an automated nucleotide sequencer at the Institute of Biochemistry and Biophysics in Warsaw. RT-PCR results showed that 6 of 27 trees were infected, with LChV-1 detected in five sweet cherry trees and LChV-2 singly infecting one sweet cherry tree cv Elton (isolate C4/14). The nucleotide sequence of the 438-bp methyltransferase gene fragment of isolate C4/14 showed 86, 85, and 84% identity to GenBank Accession Nos. AF333237, AF531505, and AJ430056, respectively, all previously reported LChV-2 sequences from cherry trees. Sequence analysis of the 1,088-bp coat protein gene showed 89 to 91% and 92 to 93% nucleotide and amino acid identity, respectively, with the aforementioned three LChV-2 isolates. The tree infected with LChV-2 was indexed by graft transmission to the woody indicator, Prunus avium cv. Canindex, which showed reddening of the leaves characteristic of LChD 3 months after inoculation. Since cherry production in Poland is 230,000 t per year, the disease may have a significant economic impact because the affected fruits are unsuitable either for consumption or sale. To our knowledge, this is the first report of LChV-2 in Poland. References: (1) M. E. Rott and W. Jelkmann. Phytopathology 91:261, 2001. (2) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005. (3) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

Download Full-text

Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽

10.1094/pdis-94-8-1067b ◽

2010 ◽

Vol 94 (8) ◽

pp. 1067-1067 ◽

Cited By ~ 2

Author(s):

K. C. Eastwell ◽

W. E. Howell

Keyword(s):

Mosaic Virus ◽

Sweet Cherry ◽

The United States ◽

Ringspot Virus ◽

Natural Occurrence ◽

Rt Pcr ◽

Fresh Market ◽

Arabis Mosaic Virus ◽

Leafroll Virus ◽

Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Download Full-text

First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽

10.1094/pdis-93-10-1073a ◽

2009 ◽

Vol 93 (10) ◽

pp. 1073-1073 ◽

Cited By ~ 2

Author(s):

L. P. Wang ◽

N. Hong ◽

G. P. Wang ◽

R. Michelutti ◽

B. L. Zhang

Keyword(s):

North America ◽

Sweet Cherry ◽

Sour Cherry ◽

Mottle Virus ◽

Rt Pcr ◽

Prunus Species ◽

Indicator Plants ◽

First Report ◽

Green Ring ◽

Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Download Full-text