Comparative Transcriptome Analysis Demonstrates the Positive Effect of the Cyclic AMP Receptor Protein Crp on Daptomycin Biosynthesis in Streptomyces roseosporus

Daptomycin, which is produced by Streptomyces roseosporus, has been characterized as a novel cyclic lipopeptide antibiotic that is effective against Gram-positive bacteria. The biosynthesis of daptomycin is regulated by various factors. In the present study, we demonstrated that the cyclic AMP receptor protein (Crp) plays an important role in producing daptomycin in the S. roseosporus industrial strain. We found that daptomycin production from the crp deletion strain decreased drastically, whereas production from the crp overexpression strain increased by 22.1%. Transcriptome and qPCR analyses showed that some genes related to the daptomycin biosynthetic gene cluster (dpt) and the pleiotropic regulator (adpA) were significantly upregulated. RNA-seq also shows Crp to be a multifunctional regulator that modulates primary metabolism and enhances precursor flux to secondary metabolite biosynthesis. These results provide guidance for the development and improvement of potential natural products.

DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702

ABSTRACTDaptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producerStreptomyces roseosporusSW0702 using a biotinylateddptEpromoter (dptEp) as a probe. The direct interaction between DepR1 anddptEpthen was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion ofdepR1led to a reduction indptEpactivity and the cessation of daptomycin production. TheΔdepR1mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression ofdepR1raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

ABSTRACTDaptomycin produced byStreptomyces roseosporusis an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized thedptR3gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion ofdptR3reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription ofdptstructural genes. DptR3 directly activated the transcription of its own gene,dptR3, but repressed the transcription of the adjacent, divergent geneorf16(which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region ofdptR3-orf16was determined by DNase I footprinting, and the palindromic sequenceTCATTGTTACCTATGCTCACAATGA(underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding.orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development inS. roseosporus.