First report of 'Candidatus Phytoplasma trifolii' associated with little leaf and floral virescence disease in Solanum violaceum from the North East Region of India.

Solanum violaceum Ortega, (Indian nightshade), is a medicinal plant belonging to the family Solanaceae. It grows naturally as a weed in agricultural fields, forest edges, road sides and fallow lands throughout the North East Region of India. It is mostly consumed as a vegetable by the native people of the region because of its promising therapeutic effects (Islam and Islam 2018). In November 2019, typical phytoplasma-suspected symptoms such as little leaf, yellowing and floral virescence were observed on S. violaceum plants (Figure 1) in Kaliabor, Nagaon district of Assam, India (26.3220′N, 92.5540′E), with about 8% incidence based on visual observations. To investigate the possibility of a phytoplasma association with the symptoms, total DNA was isolated from collected leaf samples (symptomatic-6 and asymptomatic-9) by following the CTAB protocol (Kollar et al. 1990). The DNAs isolated were assayed for the presence of phytoplasma using polymerase chain reaction (PCR) assays performed with P1/P6 primer pair for 16S rRNA gene (Deng and Hiruki 1991) and SecAfor1/SecArev3 for secA gene (Hodgetts et al. 2008). The direct PCR targeting the 16S rRNA gene and secA gene amplified a product of about 1.5 kb and 840 bp, respectively, from all the symptomatic plant samples but not from any of the asymptomatic plant samples. All amplicons were double strand sequenced and corresponding high quality sequences were deposited in the GenBank with accession numbers MW261863 for 16S rRNA gene and MW885174 for secA gene with a sequence length of 1406 bp and 532 bp, respectively. Pairwise sequence comparison of 16S rRNA gene sequence of S. violaceum phytoplasma isolate revealed 100% sequence identity with strain of ‘Candidatus Phytoplasma trifolii’ (Accession number, EF186820) and secA gene showed up to 95% sequence identity with the same organism (Accession number, KX784498). Further analyses of the 16S rRNA and secA genes based phylogenetic tree (Figure 2A and B) and the iPhyClassifier-based virtual RFLP analysis of 16S rRNA gene revealed that the phytoplasma-associated with little leaf and floral virescence of S. violaceum belongs to 16SrIV-D subgroup with a similarity coefficient of 1.0. The 16S rRNA and secA gene sequences comparison confirmed the close association of phytoplasma strain associated with S. violaceum with 16SrVI-D subgroup phytoplasma. Earlier, the 16SrVI-D subgroup of phytoplasma has been reported to be associated with many horticultural and other agricultural crops in India (Rao 2021). Recently, the 16SrVI-D strain was reported in eggplant from Assam, India (Accession number, MW261866), showing up to 100% sequence identity with S. violaceum strain (Accession number, MW261863) (Dutta et al. 2020). To the best of our knowledge, this is the first report of the association of the 16SrVI-D subgroup of phytoplasma strain with S. violaceum plant, which is an important medicinal plant widely used in folk and traditional Indian systems of medicine. Since this study has confirmed S. violaceum as a new host of 16SrVI-D group of phytoplasma, further studies on the disease epidemiology and insects vectoring the phytoplasma would help formulate effective management strategies in preventing further spread to other hosts.

First report of 16SrII group (Peanut witches’ Broom) Phytoplasmas associated with the Leucas aspera Phyllody in India

Leucas aspera (Wild.) Linn. (Family: Lamiaceae) is a commonly found weed throughout India, known for its pharmacological properties. Its white flowers and leaves are used in many Ayurvedic formulations for the treatment of chronic rheumatism, psoriasis, snake bites and skin eruptions (Prajapathi et al., 2010). During a survey of commercial flower crop fields in May 2018, a few L. aspera plants, growing as unwanted weeds in the fields and surrounding agricultural wastelands with the symptoms of phyllody, virescence and little leaves were observed in Emmekoppalu (12.2106, 76.2511; n= 1/26 plants) and Beerihundi (12.1630, 76.3225; n= 2/59 plants) localities of Mysuru district, and Srirangapatna in Mandya district (12.2541, 76.411; 1/67 plants), Karnataka- India(Figure 1). ‘n’ denotes the symptomatic/ asymptomatic samples observed. The disease incidence in the surveyed localities ranged less than four per cent. The total genomic DNA was extracted from the leaf midrib tissues of three representative symptomatic and two asymptomatic samples using the CTAB method. The phytoplasma 16S rRNA gene was amplified in nested PCR assay by P1/P7 followed by R16F2n/R16R2 primers using Long Amplification (LA) Taq polymerase (Takara, Japan). Additionally, the PCR assays were performed for the amplification of phytoplasma secA gene using the primers SecAfor1/SecArev3 and SecAfor2/SecArev3 (Hodgetts et al., 2008). The DNA templates from all the symptomatic samples generated amplicons of approximately 1.25kb (16S rRNA gene) and 480 bp (secA gene) revealing the association of phytoplasma strains. No amplifications were observed for the asymptomatic L. aspera samples. The obtained 16S rRNA gene sequences (MN223676, MT807111 and MZ093053) showed 97.96, 98.37 and 98.18 % sequence identity, respectively; with the ‘Candidatus Phytoplasma aurantifolia’, strain ‘WBDL (U15442) using EzBiocloud database. The NCBI-BLAST analysis revealed maximum identity to various Peanut witches’ Broom (PWB) phytoplasma strains. The virtual RFLP tool, iPhyClassifier delineated the Leucas phyllody phytoplasma strains (MN223676, MT807111 and MZ093053) to group 16SrII (PWB, Peanut Witches’ broom group) subgroup D with the similarity coefficient 1.0 (Zhao et al. 2009). The obtained secA gene sequences (MZ151944, MZ151945 and MZ151946) were 98.15 to 100 % similar to the strain sequences of PWB phytoplasma strains. Further, the clustering pattern in the phylogenetic trees (16S rRNA and secA genes) constructed using MEGA 7 confirmed that the Leucas phyllody phytoplasma sequences were closely related to PWB strains. To the best of our knowledge, this is the first report on the association of 16SrII-D subgroup phytoplasma with the phyllody disease of L. aspera. In India, many weeds and wild plants serve as alternative hosts of PWB phytoplasmas and aid in the emergence of related diseases in economically important crops (Thorat et al., 2016; Thorat et al., 2017). The close genetic association of phytoplasma strains found in L. aspera and many other crops indicates the presence of common insect vector(s) transmitting these phytoplasmas (Yadav et al. 2015). This report is an addition to the catalogue of the weed species harboring phytoplasma strains associated with economically important crop plants (Rao et al., 2017). The screening of phytoplasma strains in weeds, alternate hosts and known/ unknown insect vectors is therefore essential to develop management strategies and effective management of phytophagous insect vectors feeding on both weeds and crop plants.

First report of Candidatus Phytoplasma cynodontis (16SrXIV-A subgroup) associated with cauliflower phyllody and flat stem in India

Symptoms of suspected phytoplasma infection were observed in cauliflower (Brassica oleracea var. botrytis) (cultivar NS60N) at Integrated Farming System Research Station, Trivandrum, Kerala, India (08o28’28”N, 76o57’47”E) in April-2021. The disease incidence was recorded up to 10% in different fields. The disease manifested as stunting, phyllody, floral malformation and flattening of stem (Fig.1A,B). Ten symptomatic and five asymptomatic plants were assayed for the presence of phytoplasma using nested PCR assays performed with P1/P7 and R16F2n/R16R2 primer pairs for 16S rRNA gene and SecAfor1/ SecArev3 and SecAfor2/ SecArev3 for secA gene (Deng and Hiruki 1991; Gundersen and Lee 1996; Hodgetts et al. 2008). The expected amplicons of ~1.25 kb and ~480 bp were consistently amplified in all the symptomatic cauliflower samples with the phytoplasma specific universal 16S rRNA and secA gene specific primers. Nested PCR products (~1.2 kb and 480 bp) amplified from cauliflower was cloned in EcoRI restriction sites of pGEM-T Easy vector (Promega, USA). The cloned nested PCR products were directly sequenced (16S rRNA gene: Acc. Nos. MZ196223, MZ196224; secA gene: MZ215721, MZ215722) in both forward and reverse directions which showed 99.77% sequence identity with Candidatus Phytoplasma cynodontis reference strain (Acc. No. AJ550984). Further analyses of the 16S rRNA and secA genes based phylogenetic tree (Fig. 2A and B) and the iPhyClassifier-based virtual RFLP analysis of 16Sr RNA gene study demonstrated that the phytoplasma-associated with cauliflower phyllody & flat stem disease (CaPP) belonged to 16SrXIV-A subgroup with a similarity coefficient of 1.0. No amplicon was observed from any of the asymptomatic cauliflower plants with the specific tested primers of both the genes. Earlier association of 16SrXV-A subgroup (Candidatus Phytoplasma brasiliense) and 16Sr III-J subgroup in Brazil (Canale and Badendo, 2013; Rappussi et al. 2012), 16SrII-A (Candidatus Phytoplasma aurantifolia) subgroup in China (Cai et al. 2016) and 16SrVI-A (Candidatus Phytoplasma trifolii) subgroup in Iran (Salehi 2007) were reported in cauliflower. Another species of cabbage, Brassica oleracea var. capitata L. was reported as host of Ca. P. trifloii (16Sr VI-D subgroup) from north India (Gopala et al. 2018). To our knowledge, this is the first report of a ‘Candidatus Phytoplasma cynodontis’, 16SrXIV-A subgroup related phytoplasma strain associated with cauliflower phyllody and flat stem in the world. The results described in this report confirm that the 16SrXIV-A phytoplasma, a widely distributed strain associated with sugarcane, wheat, grasses, sapota and many ornamentals in India (Rao 2021), has also infected cauliflower. This is not only the first instance of cauliflower phyllody disease found in India, but also the first instance of CaPP disease caused by 16SrXIV-A subgroup phytoplasma worldwide. This report has epidemiological significance and needs immediate attention, as cauliflower is the one of the most common vegetable crop grown all over India.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrXXIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Occurrence of Phytoplasma Belonging to 16SrII Group Associated with Witches’-broom Symptoms in Emilia sonchifolia in Hainan Island of China

Emilia sonchifolia is a medical plant belonging to the family of Asteraceae, mainly used as a traditional Chinese medicine with the function of anti-inflammatory, analgesic, antibacterial and so on. During October to November 2020, the plants showing abnormal symptoms including witches’-broom, internode shortening, leaf chlorosis and leaflet were found in Hainan province, a tropical island of China. The total DNA of the plant samples were extracted using 0.10 g fresh plant leaves using CTAB method. PCR reactions were performed using primers R16mF2/R16mR1 and secAfor1/secArev3 specific for phytoplasma 16S rRNA and secA gene fragments. The target productions of the two gene fragments of phytoplasma were detected in the DNA from three symptomatic plant samples whereas not in the DNA from the symptomless plant samples. The two gene fragments of the DNA extracted from the symptomatic plant samples were all identical, with the length of 1324 bp 16S rRNA and 760 bp secA gene sequence fragments, putatively encoding 253 (secA) amino acids sequence. The phytoplasma strain was named as Emilia sonchifolia witches’-broom (EsWB) phytoplasma, EsWB-hnda strain. To our knowledge, this was the first report that Emilia sonchifolia witches’-broom disease was caused by the phytoplasma belonging to16SrII-V subgroup in Hainan island of China, with close relationship to 16SrII peanut witches’-broom group phytoplasma strains infecting the plants like peanut, Desmodium ovalifolium and cleome from the same island of China and cassava from Viet Nam.

Tephrosia purpurea Represents a New Host of 16SrII-V Subgroup Phytoplasma Associated with Witches’-Broom Disease in China

Tephrosia purpurea is a medical plant with excellent insecticidal activity belonging to the family of Leguminosae distributed throughout southern of China (Pei et al., 2013). During January to February 2021, the plants showing abnormal symptoms including witches’-broom, internode shortening, leaf chlorosis and leaflet formation, as shown in Fig.1, were found in Ledong County of Hainan Province, a tropical island in China, with about 60 % incidence. The Tephrosia purpurea disease symptoms were suspected to be induced by phytoplasma, a phloem-limited prokaryotic pathogen which can not be cultured in vitro and which causes severe financial loss and ecological damage to the island. Total DNA from the symptomatic and asymptomatic samples of Tephrosia purpurea were extracted using 0.10 g fresh plant leaves and branches by CTAB method (Doyle and Doyle, 1990). 16S rRNA and secA gene sequence fragments of phytoplasma were detected through PCR amplification using primers R16mF2/R16mR1 (Gundersen and Lee, 1996) and secAfor1/secArev3 (Hodgetts et al., 2008). The two gene sequence fragments of phytoplasma were obtained from the DNA of six symptomatic plant samples whereas not from the DNA of six asymptomatic plant samples. These amplified products were sequenced and the data were deposited in GenBank. The two gene sequence fragments of the DNA obtained from the diseased plant samples were all identical, with a length of 1335 bp for the 16S rRNA (GenBank accession: MW616560) and 729 bp for the secA gene (MW603929). The secA gene fragment putatively encodes for 242 amino acids. The phytoplasma strain was named as Tephrosia purpurea witches’-broom (TpWB) phytoplasma, TpWB-hnld strain. 16S rRNA gene sequence fragment of TpWB-hnld was analyzed by online tool iPhyClassifier (Wei et al., 2007), indicating that the pathogen strain was a member of subgroup 16SrII-V and a ‘Candidatus Phytoplasma aurantifolia’-related strain. Blast analysis based on the 16S rRNA gene sequence fragment of TpWB-hnld showed 100 % sequence identity with that of peanut witches’-broom group members (16SrII group), such as Cassava witches'-broom phytoplasma (KM280679) and Cleome sp. phytoplasma (KM280677); Blast analysis based on the secA gene sequence fragment of TpWB-hnld showed 100 % sequence identity with that of peanut witches’-broom group members (16SrII group), such as sesame phyllody phytoplasma (JN977044). Homology and phylogeny were analyzed using the software of DNAMAN 5.0 and MEGA 7.0, indicating that TpWB-hnld and other subgroup 16SrII-V phytoplasma strains, including Cassava witches'-broom phytoplasma, Cleome sp. phytoplasma, Crotalaria witches'-broom phytoplasma (EU650181) and Desmodium ovalifolium witches'-broom phytoplasma (GU113152), were clustered into one clade with 98 % bootstrap value based on the 16S rRNA gene sequence fragments; TpWB-hnld and sesame phyllody phytoplasma were clustered into one clade based on the secA gene sequence fragments. Multiple alignment based on the 16S rRNA gene sequence fragment showed that the TpWB-hnld phytoplasma strain showed 98 % sequence identity with TpWB phytoplasma strain (HG792252) belonging to 16SrII-M subgroup reported in India (Yadav et al., 2014). To our knowledge, this was the first time that 16SrII-V subgroup phytoplasma associated with Tephrosia purpurea witches’-broom disease was identified in China. Molecular analysis based on the 16S rRNA and secA gene sequence fragments indicated that TpWB-hnld phytoplasma was a member of subgroup 16SrII-V and a ‘Candidatus Phytoplasma aurantifolia’-related strain.

First report of phytoplasma belongs to 16SrXXXII group associated with witches’-broom symptoms in Trema tomentosa in China

Trema tomentosa (Roxb.) Hara belonging to Ulmaceae displayed abnormal symptoms including witches’-broom, internode shortening, leaf chlorosis and leaflet that affected seriously their growth causing financial loss and ecological damage in China. During August through September 2020, these plants with the symptoms were first found and collected in Dingan and Qinghai counties of Hainan province, China. PCR were performed using the primers R16mF2/R16mR1 and secAfor1/secArev3 specific for phytoplasma 16S rRNA and secA gene fragments. The two gene fragments of the DNA extracted from the four disease samples were identical, with length of 1303 bp 16S rRNA and 587 bp secA gene fragments. The phytoplasma strain was named as Trema tomentosa witches’-broom (TtWB) phytoplasma, TtWB-hn strain. Phylogenetic and computer-simulated RFLP analyses based on the nearly full-length 16S rRNA gene sequence indicated that the TtWB phytoplasma strain is more closely related to the 16SrXXXII-A subgroup than to the other subgroups within 16SrXXXII group. It may represent a new subgroup, designed as 16SrXXXII-D subgroup, which is distinct from the other phytoplasma subgroups within the 16SrXXXII group. To our knowledge, this is the first report showing the occurrence of the phytoplasma strain belongs to 16SrXXXII-D subgroup associated with witches’-broom disease in Trema tomentosa in China. Genetic analysis indicated that the TtWB strain was closely related to the phytoplasma strains infecting periwinkle, oil palm, coconut palm in Malyasian, Camptotheca acuminate in Yunnan province of China and Elaeocarpus zollingeri in Japan.

First report of 16SrI-B subgroup related phytoplasma associated with witches’-broom symptoms in Pericampylus glaucus in China

Pericampylus glaucus is an important medicinal plant resource containing active components with potential antitumor activity in China (Zhao & Cui, 2009). During July through August 2020, plants displayed disease symptoms including “witches’ broom”, leaf chlorosis, leaflet and internode shortening that impacted their growth (Fig. 1). These plants were first found in Dingan county of Hainan province, China. Total DNA from 12 plants were extracted using 0.10 g fresh plant leaves based on CTAB method. After amplification using primers specific for phytoplasma 16S rRNA, tuf and secA gene targets, R16mF2R16mR1 (Lee et al, 1993), fTuf1/rTuf1 (Schneider et al., 1997) and secAfor1/secArev3 (Hodgetts et al., 2008), the target bands of the three gene fragments of phytoplasma were detected in the disease sample DNA from six disease plants, and not in the healthy sample DNA from six healthy plants. Nucleotide sequences of the three genes were obtained from the PCR products sequencing and analyzed by DNAMAN 5.0 software. The three gene fragments of the DNA extracted from the disease samples were identical, with length of 1334 bp 16S rRNA (GenBank accession: MT872515), 989 bp tuf (MT755960) and 750 bp secA (MT755961) gene fragments, putatively encoding 329 (tuf) and 249 (secA) amino acids sequence separately. The phytoplasma strain was named as Pericampylus glaucus witches’-broom (PgWB) phytoplasma, PgWB-hnda strain, belonging to 16SrI-B subgroup by iPhyClassifier analysis. Homology and phylogenetic analysis indicated that based on 16S rRNA gene fragments, PgWB-hnda, pepper yellow crinkle phytoplasma PYC-hnhk (MT760793), chinaberry witches’-broom phytoplasma CWB-hnsy1 (KP662119) and CWB-hn (EF990733), periwinkle virescence phytoplasma PeV-hnhk (KP662136), with 100.0 % identity value, arecanut yellow leaf phytoplasma AYL-hnwn (FJ998269) and AYL-hn (FJ694685), with 99.8 % identity value, were clustered into one clade. Based on the analysis of tuf gene sequence fragments, PgWB was closely related to PYC-hnhk (MT755960), CWB-hnsy1 (KP662155), PeV-hnhk (KP662172) with 99.9 % identity value. Based on the analysis of secA gene sequence fragments, PgWB was closely related to CWB-hnsy1 (KP662173) with 99.7 % identity value, PYC-hnhk (MT755961), PeV-hnhk (KP662190) with 99.4 % identity value. To our knowledge, this is the first time that Pericampylus glaucus witches’-broom disease caused by 16SrI-B subgroup phytoplasma strain was found in China. Multilocus sequence analysis showed that PgWB was closely related to the phytoplasma strains causing pepper yellow crinkle, chinaberry witches’-broom, periwinkle virescence and areca palm yellow leaf diseases, all occurred in Hainan Island of China.