scholarly journals First report of 16SrII group (Peanut witches’ Broom) Phytoplasmas associated with the Leucas aspera Phyllody in India

Plant Disease ◽  
2021 ◽  
Author(s):  
K. S. Sumashri ◽  
Kiran Kirdat ◽  
Vandana Yadav ◽  
Shilpa Natraj ◽  
Gottravalli Ramanayaka Janardhana ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Crop Plants ◽  
Rrna Gene ◽  
Insect Vector ◽  
Insect Vectors ◽  
Gene Sequences ◽  
First Report ◽  
Leucas Aspera ◽  
Seca Gene

Leucas aspera (Wild.) Linn. (Family: Lamiaceae) is a commonly found weed throughout India, known for its pharmacological properties. Its white flowers and leaves are used in many Ayurvedic formulations for the treatment of chronic rheumatism, psoriasis, snake bites and skin eruptions (Prajapathi et al., 2010). During a survey of commercial flower crop fields in May 2018, a few L. aspera plants, growing as unwanted weeds in the fields and surrounding agricultural wastelands with the symptoms of phyllody, virescence and little leaves were observed in Emmekoppalu (12.2106, 76.2511; n= 1/26 plants) and Beerihundi (12.1630, 76.3225; n= 2/59 plants) localities of Mysuru district, and Srirangapatna in Mandya district (12.2541, 76.411; 1/67 plants), Karnataka- India(Figure 1). ‘n’ denotes the symptomatic/ asymptomatic samples observed. The disease incidence in the surveyed localities ranged less than four per cent. The total genomic DNA was extracted from the leaf midrib tissues of three representative symptomatic and two asymptomatic samples using the CTAB method. The phytoplasma 16S rRNA gene was amplified in nested PCR assay by P1/P7 followed by R16F2n/R16R2 primers using Long Amplification (LA) Taq polymerase (Takara, Japan). Additionally, the PCR assays were performed for the amplification of phytoplasma secA gene using the primers SecAfor1/SecArev3 and SecAfor2/SecArev3 (Hodgetts et al., 2008). The DNA templates from all the symptomatic samples generated amplicons of approximately 1.25kb (16S rRNA gene) and 480 bp (secA gene) revealing the association of phytoplasma strains. No amplifications were observed for the asymptomatic L. aspera samples. The obtained 16S rRNA gene sequences (MN223676, MT807111 and MZ093053) showed 97.96, 98.37 and 98.18 % sequence identity, respectively; with the ‘Candidatus Phytoplasma aurantifolia’, strain ‘WBDL (U15442) using EzBiocloud database. The NCBI-BLAST analysis revealed maximum identity to various Peanut witches’ Broom (PWB) phytoplasma strains. The virtual RFLP tool, iPhyClassifier delineated the Leucas phyllody phytoplasma strains (MN223676, MT807111 and MZ093053) to group 16SrII (PWB, Peanut Witches’ broom group) subgroup D with the similarity coefficient 1.0 (Zhao et al. 2009). The obtained secA gene sequences (MZ151944, MZ151945 and MZ151946) were 98.15 to 100 % similar to the strain sequences of PWB phytoplasma strains. Further, the clustering pattern in the phylogenetic trees (16S rRNA and secA genes) constructed using MEGA 7 confirmed that the Leucas phyllody phytoplasma sequences were closely related to PWB strains. To the best of our knowledge, this is the first report on the association of 16SrII-D subgroup phytoplasma with the phyllody disease of L. aspera. In India, many weeds and wild plants serve as alternative hosts of PWB phytoplasmas and aid in the emergence of related diseases in economically important crops (Thorat et al., 2016; Thorat et al., 2017). The close genetic association of phytoplasma strains found in L. aspera and many other crops indicates the presence of common insect vector(s) transmitting these phytoplasmas (Yadav et al. 2015). This report is an addition to the catalogue of the weed species harboring phytoplasma strains associated with economically important crop plants (Rao et al., 2017). The screening of phytoplasma strains in weeds, alternate hosts and known/ unknown insect vectors is therefore essential to develop management strategies and effective management of phytophagous insect vectors feeding on both weeds and crop plants.

scholarly journals First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1427-1427 ◽  
Author(s):  
S. M. Icoz ◽  
I. Polat ◽  
G. Sulu ◽  
M. Yilmaz ◽  
A. Unlu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Blight ◽  
Acid Methyl Ester ◽  
Rrna Gene ◽  
Original Strain ◽  
Gene Sequences ◽  
Xanthomonas Axonopodis ◽  
First Report ◽  
The 16S Rrna Gene

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey. References: (1) M. A. Akhtar and M. H. R. Bhatti. Pakistan J. Agric. Res. 13:95, 1992. (2) R. Chand and R. Kishun. Indian Phytopathol. 44:370, 1991. (3) D. J. Lane. Page 115 in: Nucleic Acid Techniques in Bacterial Systematics, 1991. (4) Y. Petersen et al. Australas. Plant Pathol. 39:544, 2010.

scholarly journals First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar

Plant Disease ◽  
2021 ◽  
Author(s):  
Fabian Pilet ◽  
Emilson Rakotoarisoa ◽  
M. R. Rakotomalala ◽  
Sabine Sisteron ◽  
Harisoa Nirina Razakamanana ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Cocos Nucifera ◽  
Reference Sequence ◽  
Rrna Gene ◽  
Western Coast ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Seca Gene ◽  
Lethal Yellowing

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrXXIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

scholarly journals First report of bovine anaemia associated Theileria sinensis infection and phylogenetic analyses of partial gene sequences of Theileria and Anaplasma species detected in naturally infected Malaysian cattle

2020 ◽  
Author(s):  
Onyinyechukwu Ada Agina ◽  
Mohd Rosly Shaari ◽  
Nur Mahiza Isa ◽  
Mokrish Ajat ◽  
Mohd Zamri-Saad ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pcr Amplification ◽  
Trypanosoma Evansi ◽  
Control Measures ◽  
Rrna Gene ◽  
Infected Cattle ◽  
Anaplasma Platys ◽  
Gene Sequences ◽  
First Report

Abstract Background: Serious disease outbreaks in cattle are usually associated with blood pathogens. This study aims to detect blood pathogens namely Trypanosoma evansi, Theileria, Anaplasma and Mycoplasma species, and studied their phylogenetic relationships, haemato-biochemical abnormalities and erythrocyte osmotic fragility (EOF) in Malaysian cattle. Methods: Molecular analysis was achieved by PCR amplification and sequencing of PCR amplicons of 18SrRNA gene of Theileria species, 16SrRNA genes of Anaplasma and Mycoplasma species, 16SrRNA gene of Candidatus Mycoplasma haemobos, MPSP gene of T. orientalis and RoTaT1.2 VSG gene of Trypanosoma evansi, in sixty-one (61) Kedah-Kelantan X Brahman cattle from Pahang, Malaysia. Haemato-biochemical analyses were performed using automated analysers while EOF was determined with the aid of saline solutions. Results: PCR amplification produced the expected fragment sizes for MPSP gene of T. orientalis, msp4 gene of Anaplasma marginale, 16S rRNA gene of C. M. haemobos, RoTaT1.2VSG gene of T. evansi. Nucleotide blast demonstrated that sequences of the PCR amplicons showed a high degree of molecular similarity in comparison with reference sequences. Analysis of 18SrRNA gene sequences of Theileria species and 16S rRNA gene sequences of Anaplasma species revealed Theileria sinensis and Anaplasma platys as additional species detected in these cattle. Theileria species was the most detected blood pathogen in the sampled cattle. The blood picture of all cattle group revealed poikilocytosis, anisocytosis, rouleaux formation and degenerative left shift. Erythrocyte fragility values of all the cattle groups were above the reference range. Anaemia of the macrocytic normochromic type was observed in the Trypanosoma evansi; and Anaplasma platys + Theileria sinensis double species co-infected cattle. Normocytic normochromic anaemia was observed in the T. sinensis infected cattle group. Significant (p<0.05) increases in serum liver and kidney parameters, total protein, globulin, total and unconjugated bilirubin and decreased albumin was observed in the Trypanosoma evansi infected cattle.Conclusion: We present the first report of anaemia associated with Theileria sinensis infection in Malaysian cattle. Because of the high occurrence of bovine theileriosis and detection of Anaplasma platys, there is an urgent need for appropriate preventive and control measures, as Theileria species and A. platys are of great economic and zoonotic importance respectively.

scholarly journals First Report of Alder Yellows Phytoplasma Infecting Common and Grey Alder (Alnus glutinosa and A. incana) in Montenegro

Plant Disease ◽  
2013 ◽  
Vol 97 (5) ◽  
pp. 686-686 ◽  
Author(s):  
S. Radonjić ◽  
S. Hrnčić ◽  
O. Krstić ◽  
T. Cvrković ◽  
M. Mitrović ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Alnus Glutinosa ◽  
Rrna Gene ◽  
Gene Sequences ◽  
First Report ◽  
Group Members ◽  
Different Strains ◽  
The Town

Alder yellows phytoplasmas (AldYp) of the 16SrV-group associated with common alder (Alnus glutinosa) and grey alder (A. incana) are closely related to the grapevine yellows (GY)-associated quarantine phytoplasma Flavescence dorée (FDp). AldYp have been reported in several countries where epidemic appearance of FDp has been confirmed (France, Italy, and Serbia) (1,2). To date, the presence of 16SrV-group of phytoplasmas has not been reported in Montenegro; however, the main vector of FD phytoplasma, Scaphoideus titanus, has been identified in Montenegrin vineyards since 2008. During a survey in September 2011, in the northern part of Montenegro, 12 symptomatic alder trees showing symptoms of leaf discoloration, ranging from yellow to light green, were sampled. Six samples, each comprising several symptomatic leaves, were collected from A. glutinosa at streamside in woodlands near the town Kolašin and other six samples from A. incana close to the river Lim near the town of Bijelo Polje. Leaves of six young A. glutinosa seedlings were used as controls. Total DNA was extracted from fresh leaf midribs and petioles using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Nested PCR assay was conducted on 16S rRNA gene using phytoplasma generic primers P1/P7 and F2n/R2 followed by RFLP with MseI endonuclease (Fermentas, Vilnius, Lithuania) (3). Confirmation of identification and characterization of phytoplasma positive samples was performed by amplifying the non-ribosomal metionine aminopeptidase (map) gene using FD9f5/MAPr1 and FD9f6/MAPr2 primer set (1), specific for the members of the 16SrV group phytoplasmas. Amplification products were sequenced and deposited in GenBank (KC188998 through 9001). Comparison of the map gene sequences was performed by phylogenetic analysis along with 20 reference sequences of the 16SrV-group members (1), using the neighbor-joining method in MEGA5 software (4). 16S rRNA gene amplification revealed the presence of phytoplasmas in 11 out of 12 symptomatic samples, while Mse I restriction analysis and comparison with reference strains (AldYp and FDp from Serbia) enabled affiliation of detected phytoplasmas to the 16SrV-group. None of the controls were positive for any phytoplasma. Phylogenetic analysis of the Montenegrin AldYp map gene sequences revealed presence of four different strains clustering within the previously defined clusters of the 16SrV-group members (1). Three different strains associated with symptomatic A. glutinosa were identified and they clustered either within the FD1, FD2, or PGY-C cluster, while a single detected strain from A. incana proved to be identical with PGY-A isolate of AldY phytoplasma infecting grapevine in Germany (AM384892). To our knowledge, this is the first report of the association of 16SrV-group phytoplasmas with common and grey alder in Montenegro, as well as the first report of FD-related phytoplasmas in Montenegro. Since alder trees are considered as a possible natural reservoir of the FD phytoplasmas (1), the finding of alders naturally infected with strains related to the FDp (FD1 and FD2 clusters) indicate a possible threat of economic importance to the grape production in Montenegro, which should be addressed in further research. References: (1) G. Arnaud et al. Appl. Environ. Microbiol. 73:4001, 2007. (2) T. Cvrkovic et al. Plant Pathol. 57:773, 2008. (3) I-M. Lee et al. Int. J. Syst. Evol. Bacteriol. 48:1153, 1998. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

scholarly journals First report of Candidatus Phytoplasma cynodontis (16SrXIV-A subgroup) associated with cauliflower phyllody and flat stem in India

Plant Disease ◽  
2021 ◽  
Author(s):  
A. Sajeena ◽  
Govind P. Rao ◽  
Deepu Mathew ◽  
Jacob John ◽  
M. K. Dhanya ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Brassica Oleracea ◽  
Nested Pcr ◽  
Disease Incidence ◽  
Rrna Gene ◽  
Research Station ◽  
First Report ◽  
Pcr Products ◽  
Seca Gene

Symptoms of suspected phytoplasma infection were observed in cauliflower (Brassica oleracea var. botrytis) (cultivar NS60N) at Integrated Farming System Research Station, Trivandrum, Kerala, India (08o28’28”N, 76o57’47”E) in April-2021. The disease incidence was recorded up to 10% in different fields. The disease manifested as stunting, phyllody, floral malformation and flattening of stem (Fig.1A,B). Ten symptomatic and five asymptomatic plants were assayed for the presence of phytoplasma using nested PCR assays performed with P1/P7 and R16F2n/R16R2 primer pairs for 16S rRNA gene and SecAfor1/ SecArev3 and SecAfor2/ SecArev3 for secA gene (Deng and Hiruki 1991; Gundersen and Lee 1996; Hodgetts et al. 2008). The expected amplicons of ~1.25 kb and ~480 bp were consistently amplified in all the symptomatic cauliflower samples with the phytoplasma specific universal 16S rRNA and secA gene specific primers. Nested PCR products (~1.2 kb and 480 bp) amplified from cauliflower was cloned in EcoRI restriction sites of pGEM-T Easy vector (Promega, USA). The cloned nested PCR products were directly sequenced (16S rRNA gene: Acc. Nos. MZ196223, MZ196224; secA gene: MZ215721, MZ215722) in both forward and reverse directions which showed 99.77% sequence identity with Candidatus Phytoplasma cynodontis reference strain (Acc. No. AJ550984). Further analyses of the 16S rRNA and secA genes based phylogenetic tree (Fig. 2A and B) and the iPhyClassifier-based virtual RFLP analysis of 16Sr RNA gene study demonstrated that the phytoplasma-associated with cauliflower phyllody & flat stem disease (CaPP) belonged to 16SrXIV-A subgroup with a similarity coefficient of 1.0. No amplicon was observed from any of the asymptomatic cauliflower plants with the specific tested primers of both the genes. Earlier association of 16SrXV-A subgroup (Candidatus Phytoplasma brasiliense) and 16Sr III-J subgroup in Brazil (Canale and Badendo, 2013; Rappussi et al. 2012), 16SrII-A (Candidatus Phytoplasma aurantifolia) subgroup in China (Cai et al. 2016) and 16SrVI-A (Candidatus Phytoplasma trifolii) subgroup in Iran (Salehi 2007) were reported in cauliflower. Another species of cabbage, Brassica oleracea var. capitata L. was reported as host of Ca. P. trifloii (16Sr VI-D subgroup) from north India (Gopala et al. 2018). To our knowledge, this is the first report of a ‘Candidatus Phytoplasma cynodontis’, 16SrXIV-A subgroup related phytoplasma strain associated with cauliflower phyllody and flat stem in the world. The results described in this report confirm that the 16SrXIV-A phytoplasma, a widely distributed strain associated with sugarcane, wheat, grasses, sapota and many ornamentals in India (Rao 2021), has also infected cauliflower. This is not only the first instance of cauliflower phyllody disease found in India, but also the first instance of CaPP disease caused by 16SrXIV-A subgroup phytoplasma worldwide. This report has epidemiological significance and needs immediate attention, as cauliflower is the one of the most common vegetable crop grown all over India.

scholarly journals Phytoplasma: Ecology and Genomic Diversity

1998 ◽  
Vol 88 (12) ◽  
pp. 1359-1366 ◽  
Author(s):  
Ing-Ming Lee ◽  
Dawn E. Gundersen-Rindal ◽  
Assunta Bertaccini
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Genomic Diversity ◽  
Phylogenetic Position ◽  
Ecological Niches ◽  
Rrna Gene ◽  
Insect Vectors ◽  
Plant Interactions ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences

The recent development of molecular-based probes such as mono- and polyclonal antibodies, cloned phytoplasma DNA fragments, and phytoplasma-specific primers for polymerase chain reaction (PCR) has allowed for advances in detection and identification of uncultured phytoplasmas (formerly called mycoplasma-like organisms). Comprehensive phylogenetic studies based on analysis of 16S ribosomal RNA (rRNA) or both 16S rRNA and ribosomal protein gene operon sequences established the phylogenetic position of phytoplasmas as members of the class Mollicutes, and the revealed phylogenetic interrelationships among phytoplasmas formed a basis for their classification. Based on restriction fragment length polymorphism (RFLP) analysis of PCR-amplified 16S rRNA gene sequences, phytoplasmas are currently classified into 14 groups and 38 subgroups that are consistent with groups delineated based on phylogenetic analysis using parsimony of 16S rRNA gene sequences. In the past decades, numerous phyto-plasma strains associated with plants and insect vectors have been identified using molecular-based tools. Genomic diversity of phytoplasma groups appears to be correlated with their sharing common insect vectors, host plants, or both in nature. The level of exchange of genetic information among phytoplasma strains in a given group is determined by three-way, vector-phytoplasma-plant interactions. A putative mechanism for the creation of new ecological niches and the evolution of new ecospecies is proposed.

Monoglobus pectinilyticus gen. nov., sp. nov., a pectinolytic bacterium isolated from human faeces.

2020 ◽  
Author(s):  
CC Kim ◽  
WJ Kelly ◽  
ML Patchett ◽  
GW Tannock ◽  
Z Jordens ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Sequence Similarity ◽  
Middle Lamella ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Citrus Peel ◽  
Human Faeces ◽  
The Family

© 2017 IUMS. A novel anaerobic pectinolytic bacterium (strain 14T) was isolated from human faeces. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain 14T belonged to the family Ruminococcaceae, but was located separately from known clostridial clusters within the taxon. The closest cultured relative of strain 14T was Acetivibrio cellulolyticus (89.7% sequence similarity). Strain 14T shared ~99% sequence similarity with cloned 16S rRNA gene sequences from uncultured bacteria derived from the human gut. Cells were Gram-stain-positive, non-motile cocci approximately 0.6μm in diameter. Strain 14T fermented pectins from citrus peel, apple, and kiwifruit as well as carbohydrates that are constituents of pectins and hemicellulose, such as galacturonic acid, xylose, and arabinose. TEM images of strain 14T, cultured in association with plant tissues, suggested extracellular fibrolytic activity associated with the bacterial cells, forming zones of degradation in the pectin-rich regions of middle lamella. Phylogenetic and phenotypic analysis supported the differentiation of strain 14T as a novel genus in the family Ruminococcaceae. The name Monoglobus pectinilyticus gen. nov., sp. nov. is proposed; the type strain is 14T (JCM 31914T=DSM 104782T).

scholarly journals The Termite Group I Phylum Is Highly Diverse and Widespread in the Environment

2007 ◽  
Vol 73 (20) ◽  
pp. 6682-6685 ◽  
Author(s):  
Daniel P. R. Herlemann ◽  
Oliver Geissinger ◽  
Andreas Brune
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Rrna Gene ◽  
Gene Sequences ◽  
16S Rrna Gene Sequences ◽  
Specific Primers ◽  
Environmental Distribution ◽  
Data Set ◽  
Group I

ABSTRACT The bacterial candidate phylum Termite Group I (TG-1) presently consists mostly of “Endomicrobia,” which are endosymbionts of flagellate protists occurring exclusively in the hindguts of termites and wood-feeding cockroaches. Here, we show that public databases contain many, mostly undocumented 16S rRNA gene sequences from other habitats that are affiliated with the TG-1 phylum but are only distantly related to “Endomicrobia.” Phylogenetic analysis of the expanded data set revealed several diverse and deeply branching lineages comprising clones from many different habitats. In addition, we designed specific primers to explore the diversity and environmental distribution of bacteria in the TG-1 phylum.

Sign in / Sign up

Export Citation Format

Share Document